Biochemistry 3 (tests)

123 Questions

Settings
Please wait...
Biochemistry Quizzes & Trivia

Questions and Answers
  • 1. 
    The component (s) of DNA which is responsible for the absorbanc band at 250-270 nm is
    • A. 

      Bases, pentoses, and phosphates all contribute

    • B. 

      Only bases

    • C. 

      Only bases and pentoses

    • D. 

      Only pentoses and phosphates

  • 2. 
    To what target sequence on DNA is the oligonucleotide pAATTCCGG complementary? (sequence are written as 5'-3')
    • A. 

      TTAAGGCC

    • B. 

      CCGGAATT

    • C. 

      UUAAGGCC

    • D. 

      CCGGAAUU

  • 3. 
    In eukaryotic cells, the only RNA molecule which has a poly (A) tail attached to the 3' end is
    • A. 

      MRNA

    • B. 

      TRNA

    • C. 

      SS RNA

    • D. 

      All rRNA's

  • 4. 
    The RNA molecules which are involved in processing the hnRNA are
    • A. 

      MRNA

    • B. 

      TRNA

    • C. 

      RRNA

    • D. 

      SnRNA

  • 5. 
    Partial digestion of the oligonucleotide d-AGTACAA by pancreatic phosphodiesterase (a "b" cutter) would result in which set of products?
    • A. 

      AGP, pAC, pAA

    • B. 

      AGPp, AC, pAA

    • C. 

      AGp, TAp, CAA

    • D. 

      AG, TAp, pCCA

  • 6. 
    Which of the following is not a characteristic for DNA synthesis?
    • A. 

      DNA polymerase adds nucleotides in a 5' --> 3' direction

    • B. 

      A primer strand of DNA must contain a free 3'-OH end

    • C. 

      The primer strand of DNA determines which nucleotides are added next

    • D. 

      The correct complementary hydrogen bonding between base pairs is the primary check on the fidelity of the newly synthesized DNA

  • 7. 
    A DNA is found to exhibit a melting temperature of 75 degrees Celsius in 0.1M NaCl.  Under what experimental conditions would the Tm be increased? (pg 372)
    • A. 

      Decreasing the concentration of DNA

    • B. 

      Increasing the concentration of NaCl in the solution

    • C. 

      Adding 1% urea (an organic denaturant)

    • D. 

      All of the above

  • 8. 
    Which of the following characteristics is associated with the B form of DNA?
    • A. 

      The sugars are located in the interior of the double helix

    • B. 

      B

  • 9. 
    A feature which is distinctive to Z-DNA is
    • A. 

      A left-handed helix

    • B. 

      it has 12 bases per turn

    • C. 

      It is found in vivox

    • D. 

      All of the above

  • 10. 
    • A. 

      500

    • B. 

      50

    • C. 

      450

    • D. 

      350

  • 11. 
    The linking number of a highly supercoiled plasmid can be readily changed without producing a relaxed DNA by
    • A. 

      Changing the temperature

    • B. 

      Increasing salt concentration

    • C. 

      The action of topoisomerase

    • D. 

      The action of a nuclease such as pancreatic DNAse

  • 12. 
    Under which of the following conditions does the melting temperature for the denaturation of duplex DNA decrease?
    • A. 

      Higher salt concentration in the buffer

    • B. 

      Higher GC content in the DNA

    • C. 

      PH higher than 10 in the buffer

    • D. 

      Longer DNA fragments

  • 13. 
    • A. 

      ATGCATGCATGCATGC / TACGTACGTACGTACG

    • B. 

      AAAAAAAAACCCCCCCCC / TTTTTTTTTGGGGGGGGC

    • C. 

      ATATATATGCGCGCGCGC / TATATATACGCGCGCGCG

    • D. 

      CATTAAGCAGTGCTTAAGA / GAATTCGTCACGAATTCT

  • 14. 
    Which of the following statements is incorrect when dsDNA is denatured? (pg 371-2)
    • A. 

      The absorbance at 260 decreases about 40%

    • B. 

      The hgiher the G+C content, the higher the melting temperature

    • C. 

      The transition from dsDNA to ssDNA is highly cooperative

    • D. 

      The fraction of DNA that is single stranded is 0.5 at its Tm

  • 15. 
    • A. 

      It serves as the start point for the new DNA strand

    • B. 

      It serves as a guide in determining the next nucleotide to be added by the polymerase

    • C. 

      It increases the processivity of the DNA polymerase

    • D. 

      It is essential for the 3-5' exonuclease activity

  • 16. 
    In the repair of DNA, the E.coli DNA polymerase invovled performs which function in addition to its polymerase activity?
    • A. 

      It recognizes the abnormality in the duplex DNA structure.

    • B. 

      It nicks the DNA to provide a 3'-OH

    • C. 

      It removes the damaged section of DNA with its 5'-3' exonuclease activity

    • D. 

      It ligates the DNA after the repair synthesis

  • 17. 
    • A. 

      It insures the fidelity of the newly synthesized DNA strand

    • B. 

      The DNA polymerases require a preexisting strand with a nucleotide having a 3'-OH.

    • C. 

      The DNA polymerases require a preexisting strand with a nucleotide having a 5'-OH.

    • D. 

      All of the above are correct

  • 18. 
    The Klenow fragment of E. coli DNA polymerase I can be used to add nucleotides to a DNA with staggered ends if the ends...
    • A. 

      Are recessed with 5'-phosphates

    • B. 

      Are recessed with 3'-OHs

    • C. 

      Are extended with 5'-phosphates

    • D. 

      Are extended with 3'-OHs

  • 19. 
    Which E. coli DNA polymerase is responsible for the repair of DNA?
    • A. 

      DNA polymerase I

    • B. 

      Klenow fragment

    • C. 

      DNA polymerase II

    • D. 

      DNA polymerase III

  • 20. 
    The Klenow fragment from E.coli DNA polymerase contains all of the following except (pg 993)
    • A. 

      DNA polymerase activity

    • B. 

      5'-3' exonuclease activity

    • C. 

      The large fragment from the C-terminal end of the polymerase

    • D. 

      3'-5' exonuclease activity

  • 21. 
    E. coli replication on the lagging strand (pg 1002)
    • A. 

      Is primarily carried out by DNA polymerase I

    • B. 

      Is synthesized continuously

    • C. 

      This DNA strand is synthesized in a 3'-5' direction of synthesis

    • D. 

      Is initially synthesized as Okazaki fragments

  • 22. 
    Which one of the following characteristics ls not associated with E.coli primase?
    • A. 

      It syntheslzes the RNA primer in DNA repllcation.

    • B. 

      It is a specific RNA polymerase

    • C. 

      It is essential for DNA replication

    • D. 

      It is also a gyrase

  • 23. 
    The polymerase which plays a similar role as that of Prokaryotic Pol III in eukaryotic replication is (pg 1006)
    • A. 

      DNA polymerase alpha

    • B. 

      DNA polymerase alpha

    • C. 

      DNA polymerase delta

    • D. 

      DNA polymerase alpha

  • 24. 
    Which is not a property of E.coli DNA polymerase III?
    • A. 

      It is responsible for incorporating most of the nucleotides in the lagging strand

    • B. 

      It synthesizes most of the leading strand prior to aiding in the synthesis of the lagging strand

    • C. 

      It contains a 3' to 5' exonuclease activity

    • D. 

      It synthesizes the leading strand and the lagging strand at the same time

  • 25. 
    Which of the following enzymes possesses a 5' to 3' exonuclease activity?
    • A. 

      Primase

    • B. 

      DNA polymerase I

    • C. 

      DNA polymerase III

    • D. 

      DNA gyrase

  • 26. 
    Which statement is INCORRECT about E. coli DNA polymerase I? (pg 991)
    • A. 

      The cell contains more molecules of DNA pol I than DNA pol III

    • B. 

      DNA pol I is a single polypeptide with three domains

    • C. 

      DNA pol I is involved in the repair of UV damaged DNA

    • D. 

      DNA pol I has a larger turnover number than DNA pol III

  • 27. 
    Which statement is INCORRECT about E. coli DNA ligase?
    • A. 

      It functions int he replication but not in the repair of DNA

    • B. 

      It forms a "DNA-AMP" covalent complex during the reaction it catalyzes

    • C. 

      It can seal nicks in the dsDNA as long as the adjacent nucleotides surrounding the nick contain a free 3' hydroxyl and a 5' phosphate

    • D. 

      It catalyzes the formation of a phosphoester bond in dsDNA

  • 28. 
    Which E. coli enzyme has the greatest frequency of incorporating the incorrect nucleotide into its nucleic acid polymer?
    • A. 

      RNA polymerase

    • B. 

      DNA polymerase I

    • C. 

      DNA polymerase III

    • D. 

      Klenow fragment from DNA polymerase I

  • 29. 
    Which one of the following DNA sequences is palindromic?
    • A. 

      GCGCGCGCGCGC / CGCGCGCGCGCG

    • B. 

      GGGGGGGGCGA / CCCCCCCCGCC

    • C. 

      ATGCATGC / TACGTACG

    • D. 

      GGCCGGCCGG / CCGGCCGGCC

  • 30. 
    The synthesis of the DNA strand is thermodynamically driven by
    • A. 

      The dNTP hydrolysis to produce the incorporated NMP and the PPi

    • B. 

      The nature of the strong connecting bonds formed int he linked nucleotides

    • C. 

      The dNTP hydrolysis and the subsequent hydrolysis of PPi by pyrophosphatase

    • D. 

      The inherent stability of the synthesized DNA polynucleotide

  • 31. 
    The promoter site is
    • A. 

      The start base for transcription in DNA

    • B. 

      The binding site in DNA for regulatory proteins which stimulate or further promote the level of transcription

    • C. 

      The site on DNA at which RNA polymerase binds to initiate transcription

    • D. 

      The general region of DNA downstream from the start site.

  • 32. 
    Which of the following factors or subunits is contained within the core RNA polymerase in prokaryotic organisms? (pg 1016)
    • A. 

      Alpha, beta, and beta'

    • B. 

      Alpha, beta, beta', and gamma holoenzyme

    • C. 

      TFIID, SP1 and enhancer protein

    • D. 

      TF IIIA, TFIIIB, and TFIIIC

  • 33. 
    The subunit in E. coli RNA polymerase which is required fro recognition of the promoter sequence is
    • A. 

      Alpha

    • B. 

      Beta

    • C. 

      Beta prime

    • D. 

      Gamma

  • 34. 
    RNA polymerase II (pg 102)
    • A. 

      Is located int he nucleolus and transcribes the major ribosomal RNA genes

    • B. 

      Is located in the nucleoplasm (general nucleus) and transcribes protein-encoding genes

    • C. 

      Transcribes the 5S RNA genes

    • D. 

      Transcribes RNAs associated with mRNA processing (SNRP's)

  • 35. 
    The lac operon includes (pg 1031)
    • A. 

      The structural genes for lacZ, lacY, and lacA

    • B. 

      The three structural genes listed in (a) and the operator and promoter sequences for these genes

    • C. 

      All elements listed in (b) and the lacI gene

    • D. 

      All elements in (c) and the promoter for lacI

  • 36. 
    Which statemnt is INCORRECT aobut enhancer sequences in eukaryotes (pg 1015)
    • A. 

      They can occur within a gene

    • B. 

      They can occur either 3' or 5' to the gene

    • C. 

      They can be in either orientation

    • D. 

      They can be placed at different distances from the gene without changing their influence

  • 37. 
    Which statement is INCORRECT about eh synthesis of RNA by RNA polymerase in E. coli?
    • A. 

      A

    • B. 

      B

  • 38. 
    Prokaryotic genes have conserved DNA sequences centered around -10 and -35 before the initiation point of transcription.  THese regions contain a binding site for:
    • A. 

      The rho protein

    • B. 

      DNA polymerase

    • C. 

      Ribosomes

    • D. 

      RNA polymerase holoenzyme

  • 39. 
    A strain of E. coli produces the same high level of beta-galactosidase regardless of the concentration of lactose in the medium.  This strain most liekly contains a deletion mutation in the gene (Note: you may assume that the deletion mutation causes loss of normal function) (pg 10)
    • A. 

      Lac 1

    • B. 

      Lac 2

    • C. 

      Gene coding for the gamma-subunit of RNA polymerase

    • D. 

      Gene encoding the catabolite activator protein

  • 40. 
    Which statement is CORRECT about  RNA polymerase in E. coli?
    • A. 

      It transcribes the DNA sense strand

    • B. 

      It transcribes the DNA antisense strand

    • C. 

      It transcribes only protein genes

    • D. 

      It translates DNA into protein

  • 41. 
    Which statement is INCORRECT about a typical E. coli promoter? (pg 1019)
    • A. 

      It consists of approximately 60 bp of dsDNA

    • B. 

      It is recognized and bound by the gamma-subunit of RNA polymerase holoenzyme

    • C. 

      The base sequences centered at -10 of various promoters are not identical but almost always differ by two or fewer bases from the consensus sequence

    • D. 

      It contains a "GC rich" consensus seuqence centered at =10 called the Pribnow box

  • 42. 
    The reason why DNA does not contain uracyl is because
    • A. 

      Uracyl forms unstable hydrogen bonds

    • B. 

      Cytosine spontaneously becomes uracyl

    • C. 

      Thymine can do the same function as uracyl

    • D. 

      Uracyl can only from glycosidic bonds with ribose

  • 43. 
    In the Sanger's DNA sequencing method of the following oligonucleotide, what will be the sequence read form the gel? AATCGATTCGGGCTATA.  The primer is 4 nucleotides long. (pg 359)
    • A. 

      AATCGATTCGGGCTATA

    • B. 

      TTAGCTAAGCCCGATAT

    • C. 

      The primer strand plus TTAGCTAAGCCCG

    • D. 

      TTAGCTAAGCCCG

  • 44. 
    An enzyme that changes the shape of supercoiled DNA without changing its linking number is (pg 376 or 576)
    • A. 

      Gyrase

    • B. 

      Topoisomerase II

    • C. 

      Helicase

    • D. 

      Topoisomerase I

  • 45. 
    Which polymerase has the highest processivity?
    • A. 

      DNA Polymerase III

    • B. 

      DNA Polymerase gamma

    • C. 

      DNA Polymerase delta

  • 46. 
    The genes for the enzymes needed int he synthetic pathway of a biomolecule usually are found int he form of
    • A. 

      Gene families

    • B. 

      An operon

    • C. 

      Housekeeping genes

    • D. 

      Oncogenes

  • 47. 
    The term "upstream" means (p 1019)
    • A. 

      Any place int he DNA after the promoter site

    • B. 

      Any place in the DNA at the noncoding region

    • C. 

      A consensus sequence that goes from 3' to 5'

    • D. 

      Any region in the DNA that is closer to the 5' end

  • 48. 
    Telomerase is an enzyme that (p 1008)
    • A. 

      Decreases the size of the telomeres

    • B. 

      Extends the 3' end of the telomeres lagging strand

    • C. 

      It is not found in vertebrates

    • D. 

      Uses a DNA primer to enxtend DNA

  • 49. 
    A strain of E.coli produces the same high level of beta-galactosidase regardless of concentration of lactose in the medium. This strain most likely contains a deltion mutation int he gene (Note: you may assume that deletion mutation causes normal function
    • A. 

      Lac I

    • B. 

      Lac 2

    • C. 

      Gene coding for the gamma-subunit of RNA polymerase

    • D. 

      Gene encoding the catabolite activator protein

  • 50. 
    Which statement is INCORRECT about RNA polymerase in E. coli?
    • A. 

      It does not contain a 3' or 5' exonuclease activity

    • B. 

      Its holoenzyme contains four different subunits organized as alpha beta beta prime, gamma

    • C. 

      It synthesizes mRNA, tRNA, rRNA as well as the RNA primers during replication

    • D. 

      It uses the nucleotides UTP, GTP, ATP, and CTP as substrates

  • 51. 
    Which statement is incorrect about a typical E. coli promoter?
    • A. 

      It consists of approximately 60 bp of dsDNA

    • B. 

      It is recognized and bound by the gamma subunit of RNA polymerase holoenzyme

    • C. 

      The base sequences centered at -10 of various promoters are not identical but always differ by two or fewer bases form the consensus sequence

    • D. 

      It contains a "GC rich" consensus sequence centered at -10 called the pribnow box

  • 52. 
    • A. 

      Depurinated

    • B. 

      Dephosphorylated

    • C. 

      Annealed

    • D. 

      Less active

  • 53. 
    In duplex DNA, how many hydrogen bonds does thymine use?
    • A. 

      2

    • B. 

      3

    • C. 

      4

    • D. 

      1

  • 54. 
    One of the following is used for protein synthesis:
    • A. 

      ATP

    • B. 

      UTP

    • C. 

      CTT

    • D. 

      GTP

  • 55. 
    The molecule that carries the pure genetic message in eukaryotes is:
    • A. 

      Antisense DNA

    • B. 

      MRNA

    • C. 

      Sense DNA

    • D. 

      HnRNA

  • 56. 
    If snake venon phosphodiesterase (3' - "a" cutter) cleaved the molecule above, what fragments would you expect as a result
    • A. 

      PG, pATAC

    • B. 

      PGp, ATAC

    • C. 

      PGATA, pC

    • D. 

      PGATAp, C

  • 57. 
    In dsDNA the direction of the strand is
    • A. 

      Both are 5'-3'

    • B. 

      One is 5'-3' and other is 3'-5'

    • C. 

      Both are 3'-5'

    • D. 

      None of the above

  • 58. 
    The nucleic acid that is unstable in ACID is
    • A. 

      DNA

    • B. 

      MRNA

    • C. 

      RRNA

    • D. 

      TRNA

  • 59. 
    The reason why DNA is stable in BASE and RNA is not is because
    • A. 

      RNA is single stranded

    • B. 

      DNA is more basic

    • C. 

      DNA is complexed with proteins

    • D. 

      RNA has a 2-OH group

  • 60. 
    In the Sanger's DNA sequencing method, what is the reason for the stop of the chain elongation?
    • A. 

      The dideoxynucleotide triphosphate (DTP)

    • B. 

      The primer strand

    • C. 

      The template strand has been synthesized with stops in it

    • D. 

      One of the dNTPs

  • 61. 
    Which of the following double-stranded DNAs may convert to a cruciform structure?
    • A. 

      ATGCATGCATGCATGCACGTACGTACGTACG

    • B. 

      ATATATATGCGCGCGCGCTATATATACGCGCGCGCG

    • C. 

      CATTAAGCAGTGCTTAAGAGTAATTCGTCACGAATTCT

    • D. 

      AAAAAAAAACCCCCCCCTTTTTTTTTGGGGGGGG

  • 62. 
    Which statement is INCORRECT about the structure of native E.coli chromosomal DNA?
    • A. 

      The DNA is primarily in the B-helix

    • B. 

      The DNA is circular and supercoiled

    • C. 

      The DNA exists as a right handed double helix

    • D. 

      The DNA is one large linear piece about 4000 kb in length

  • 63. 
    Which item of experimental evidence gives the most support to the conclusion that "Every PURINE BASE pairs with a PYRIMIDINE BASE"
    • A. 

      % of A = % of G

    • B. 

      % of C = % of T

    • C. 

      % of PURINES = % of PYRIMIDINE

    • D. 

      % of Percent Base Composition in any organism is the same in all cells of the organism and is characteristic of that

  • 64. 
    All are true of the DNA double helix EXCEPT:
    • A. 

      The strands are parallel

    • B. 

      The strands are held by hydrogen bonds

    • C. 

      The strands are complementary

    • D. 

      The strands dissociate with high Urea

  • 65. 
    In eukaryotes, a DNA is found in:
    • A. 

      The nucleus, ribosomes, and mitochondria

    • B. 

      The nucleus, mitochondria, and chloroplasts

    • C. 

      The nucleus, and mitochondria

    • D. 

      The nucleus

  • 66. 
    In the repair of DNA, the E.coli DNA polymerase involved performs which function in addition to its polymerase activity?
    • A. 

      It recognizes the abnormality in the duplex DNA structure

    • B. 

      It removes the damaged section of DNA with its 5'-3' exonuclease activity

    • C. 

      It nicks DNA to provide a 3'-OH

    • D. 

      It ligates the DNA after the repair synthesis

  • 67. 
    Why is a primer strand needed in DNA replication?
    • A. 

      It insures the fidelity of the newly synthesized DNA strand

    • B. 

      The DNA polymerases require a preexisting strand with a nucleotide having a 5'-OH

    • C. 

      The DNA polymerases require a preexisting strand with a nucleotide having a 3'-OH

    • D. 

      All of the above are correct

  • 68. 
    Which one of the following characteristics IS NOT associated with E. coli PRIMASE?
    • A. 

      It is essential for DNA replication

    • B. 

      It synthesizes the RNA primer in DNA replication

    • C. 

      It is also a gyrase

    • D. 

      It is a specific RNA polymerase

  • 69. 
    In the processing of the Okazaki fragments into a continuous DNA strand in E. coli, which of the following enzyme activity IS NOT required?
    • A. 

      Polymerase I

    • B. 

      Ligase

    • C. 

      RNA-H

    • D. 

      DNAse

  • 70. 
    Telomerase is found in humans in
    • A. 

      Somatic cells

    • B. 

      Tumor cells

    • C. 

      Senescent cells

    • D. 

      Only found in prokaryotes

  • 71. 
    The subunit involved in melting dsDNA in RNA polymerase is
    • A. 

      α (alpha)

    • B. 

      γ (gamma)

    • C. 

      σ (sigma)

    • D. 

      δ (delta)

  • 72. 
    TRANSCRIPTION is throught to generate
    • A. 

      Positive supercoils BEHIND the transcription bubble

    • B. 

      Positive supercoils IN FRONT of the transcription bubble

    • C. 

      Negative supercoils IN FRONT of the transcription

    • D. 

      A relaxed DNA during the transcription process

  • 73. 
    Since the HEPTAPEPTIDE repeats (in the carboxy terminal domain located in the large subunit of RNA Polymerase II) can be phosphorylated, the repeats must contain:
    • A. 

      Serine

    • B. 

      Aspartic Acid

    • C. 

      Histidine

    • D. 

      Tryptophan

  • 74. 
    The Pribnow box is located
    • A. 

      At -10 from the ENHANCER ELEMENT

    • B. 

      At -10 bp from the INITIATION SITE

    • C. 

      At -35 bp from the OPERATOR

    • D. 

      At -35 bp from STARTING CODON

  • 75. 
    The RNA Polymerase SLOWS down in
    • A. 

      AT regions

    • B. 

      Poly A regions

    • C. 

      UA regions

    • D. 

      GC regions

  • 76. 
    INCREASE in gene expression in response to a METABOLITE is called:
    • A. 

      Induction

    • B. 

      Repression

    • C. 

      Co-Induction

    • D. 

      Co-Repression

  • 77. 
    LEUCINE is coded by 6 different codons, this represents
    • A. 

      Degeneracy

    • B. 

      Synonymous codons

    • C. 

      Unambiguous codons

    • D. 

      All of the above

  • 78. 
    One of these codons is likely to code for NON-POLAR amino acid
    • A. 

      GUU

    • B. 

      GAC

    • C. 

      GGG

    • D. 

      GAA

  • 79. 
    T-RNA (Met) and t-RNA (fMet)
    • A. 

      Can recognize the AUG codon

    • B. 

      Are the same t-RNA but with different amino acids

    • C. 

      Are used by eukaryotes and prokaryotes

    • D. 

      None of the above

  • 80. 
    In eukaryotic translation
    • A. 

      The t-RNA (Met) is used for INITIATION and ELONGATION

    • B. 

      The t-RNA (Met) is used for INITIATION only

    • C. 

      Is INITIATED with t-RNA (fMet)

    • D. 

      There are two separate t-RNA (Met) used for INITIATION and ELONGATION

  • 81. 
    The oligonucleotide, AUGGp, has all these properties, EXCEPT
    • A. 

      Composed of ribonucleotides

    • B. 

      Contains a 3' phosphate

    • C. 

      Composed of deoxyribonucleotides

    • D. 

      Contains three phosphodiester bonds

  • 82. 
    An individual heterogeneous nuclear RNA (hnRNA)
    • A. 

      Contains INTRON sequences not found in the final mature mRNA

    • B. 

      Contains EXON sequences which are removed prior to translation

    • C. 

      Encodes MORE THAN ONE protein

    • D. 

      Can be found in the CYTOPLASM

  • 83. 
    The RNA molecules which are involved in PROCESSING the hnRNA are
    • A. 

      MRNA

    • B. 

      TRNA

    • C. 

      RRNA

    • D. 

      SnRNA

  • 84. 
    • A. 

      TRNA contains numerous intramolecular HYDROGEN BONDS between bases

    • B. 

      There are MORE DISTINCT tRNA molecules than there are rRNA molecules

    • C. 

      RRNA are complexed to PROTEINS in the ribosome

    • D. 

      The MOST ABUNDANT RNA molecule in the cell is mRNA

  • 85. 
    Which of the following IS NOT a characteristic for DNA synthesis?
    • A. 

      DNA polymerase ADDS nucleotides in a 5'-3' direction

    • B. 

      A PRIMER STRAND of DNA must contain a free 3'-OH end

    • C. 

      The PRIMER STRAND of DNA DETERMINES which nucleotide are ADDED NEXT

    • D. 

      The correct COMPLEMENTARY HYDROGEN BONDING between base pairs is the PRIMARY CHECK on the fidelity of the newly synthesized DNA

  • 86. 
    A DNA is found to exhibit a melting temperature of 75 C in 0.1 M NaCl.  Under what experimental conditions would the Tm be INCREASED?
    • A. 

      DECREASING the concentration of DNA

    • B. 

      INCREASING the concentration of NaCl in the solution

    • C. 

      ADDING 1% urea (an organic denaturant)

    • D. 

      All of the above

  • 87. 
    A feature which is distinctive to Z-DNA is
    • A. 

      A LEFT-HANDED helix

    • B. 

      It has 12 BASES per turn

    • C. 

      It is found IN VIVO

    • D. 

      All of the above

  • 88. 
    The linking number of a highly SUPERCOILED plasmid can be readily changed WITHOUT producing a relaxed DNA by:
    • A. 

      Changing the TEMPERATURE

    • B. 

      INCREASING the salt concentration

    • C. 

      The action of TOPOISOMERASE

    • D. 

      The action of a NUCLEASE such as pancreatic DNAse

  • 89. 
    Which statement is INCORRECT about the STRUCTURE of native E. COLI chromosomal DNA?
    • A. 

      The DNA is primarily in the BETA-helix

    • B. 

      The DNA is CIRCULAR and SUPERCOILED

    • C. 

      The DNA exists as a RIGHT-HANDED double helix

    • D. 

      The DNA is one large LINEAR piece about 4000 kb in length

  • 90. 
    E. coli DNA POLYMERASE I has all of the following characteristics EXCEPT
    • A. 

      A 5'-3' EXONUCLEASE activity on a SECOND subunit in the POLYMERASE

    • B. 

      A 3'-5' EXONUCLEASE activity

    • C. 

      A 5'-3' DNA POLYMERASE activity

    • D. 

      MODEST processivity (20 nucleotides)

  • 91. 
    IN THE REPAIR of DNA, the E.coli DNA POLYMERASE involved performs which function IN ADDITION to its polymerase activity?
    • A. 

      It RECOGNIZES the ABNORMALITY in the duplex DNA structure

    • B. 

      It NICKS the DNA to provide a 3'-OH

    • C. 

      It REMOVES the DAMAGED section of DNA with its 5'-3' EXONUCLEASE activity

    • D. 

      It LIGATES the DNA after the REPAIR synthesis

  • 92. 
    The KLENOW fragment of E. Coli DNA Polymerase I can be used to ADD nucleotides to a DNA WITHOUT staggered ends,  IF THE ENDS...
    • A. 

      Are RECESSED with 5'-phosphates

    • B. 

      Are RECESSED with 3'-OHs

    • C. 

      Are EXTENDED with 5'-phosphates

    • D. 

      Are EXTENDED with 3'-OHs

  • 93. 
    Which of the following IS NOT a characteristic of REPLICATION of the E.coli CIRCULAR chromosome?
    • A. 

      Replication is BIDIRECTIONAL

    • B. 

      It INITIATES at a unique position called oriC

    • C. 

      TORSIONAL STRESS introduced in the duplex DNA is relieved by DNA GYRASE

    • D. 

      The UNWINDING of the duplex DNA is driven by the TRANSLOCATION of the DNA Polymerase

  • 94. 
    E. coli REPLICATION on the LAGGING strand
    • A. 

      Is primarily carried out by DNA Polymerase I

    • B. 

      Is synthesized CONTINUOUSLY

    • C. 

      This DNA strand is synthesized int he 3'-5' direction of the synthesis

    • D. 

      Is initially synthesized as OKAZAKI FRAGMENTS

  • 95. 
    Which of the following characteristic IS NOT associated with E. coli PRIMASE
    • A. 

      It synthesizes the RNA PRIMER in DNA replication

    • B. 

      It is a SPECIFIC RNA polymerase

    • C. 

      It is ESSENTIAL for DNA replication

    • D. 

      It is also a GYRASE

  • 96. 
    The POLYMERASE IN EUKARYOTIC REPLICATION which plays a similar role as that of PROKARYOTIC'S Polymerase III is?
    • A. 

      DNA Polymerase γ (gamma)

    • B. 

      DNA Polymerase δ (delta)

    • C. 

      DNA Polymerase σ (sigma)

    • D. 

      DNA Polymerase α (alpha)

  • 97. 
    Which IS NOT a property of E. coli DNA Polymerase III?
    • A. 

      It is responsible for incorporating MOST of the NUCLEOTIDES in the LAGGING strand

    • B. 

      It synthesizes MOST of the LEADING strand PRIOR to aiding in the synthesis of the LAGGING strand

    • C. 

      It contains a 3'-5' EXONUCLEASE activity

    • D. 

      It synthesizes the LEADING strand and the LAGGING strand at the SAME TIME

  • 98. 
    Which statement is INCORRECT about E. coli DNA Polymerase I?
    • A. 

      The cells contain MORE MOLECULES of DNA pol I than DNA pol III

    • B. 

      DNA pol I is a SINGLE POLYPEPTIDE with THREE domains

    • C. 

      DNA pol I is involved in the REPAIR of UV-damaged DNA

    • D. 

      DNA pol I has a LARGER TURNOVER number than DNA pol III

  • 99. 
    Which E. coli ENZYME has the GREATEST FREQUENCY of incorporating the INCORRECT NUCLEOTIDE into is nucleic acid POLYMER?
    • A. 

      RNA polymerase

    • B. 

      DNA polymerase I

    • C. 

      DNA polymerase III

    • D. 

      KLENOW fragment from DNA polymerase I

  • 100. 
    DNA-DEPENDENT RNA polymerase acts on the DNA template in EUKARYOTIC CELLS in the SYNTHESIS of:
    • A. 

      A 5'-3' hnRNA TRANSCRIPT as the RNA polymerase moves in the 3'-5' direction on the DNA template

    • B. 

      A mature RNA transcript a the RNA polymerase moves in the 5'-3' direction

    • C. 

      An RNA transcript, with the SIGMA subunit of polymerase DISSOCIATING after the initiation event

    • D. 

      An RNA transcript, which is COMPLEMENTARY to the SENSE strand of the DNA, except for the REPLACEMENT of the uridines for the thymidines

  • 101. 
    In eukaryotes, there are many MORE PROTEINS than GENES.  This can be explained by
    • A. 

      Association of proteins

    • B. 

      Multiple subunites

    • C. 

      Alternative splicing

    • D. 

      Mutation

  • 102. 
    If you found a DNA molecule containing URACYL, the most probably CAUSE for it would be:
    • A. 

      A mutation

    • B. 

      A MISTAKE by the polymerase

    • C. 

      A cytosine DEAMINATION

    • D. 

      A probably ISOLATED RNA

  • 103. 
    Pure DNA has an absorbance ratio of:
    • A. 

      260/280 = 2.0

    • B. 

      280/260 = 1.8

    • C. 

      260/280 = 1.8

    • D. 

      260/240 = 1.6

  • 104. 
    In the RELAXED "B" DNA, one of these group of numbers is CORRECT:
    • A. 

      W=0, L=20, T=20

    • B. 

      W=20, L=20, T=0

    • C. 

      T=20, L=20, W=40

    • D. 

      L=40, W=20, T=20

  • 105. 
    DOUBLE-stranded RNA is found in?
    • A. 

      Ribosomes

    • B. 

      T-RNA

    • C. 

      MRNA

    • D. 

      RNA is NEVER double-stranded

  • 106. 
    E. coli DNA polymerase I has all of the following characteristics EXCEPT:
    • A. 

      A 3'-5' EXONUCLEASE activity

    • B. 

      A 5'-3' DNA polymerase activity

    • C. 

      A 5'-3' EXONUCLEASE activity ON A SECOND subunit in the polymerase

    • D. 

      MODEST processivity (20 nucleotides)

  • 107. 
    The KLENOW fragment has the following activities
    • A. 

      POLYMERASE and 3'-EXONUCLEASE

    • B. 

      3' and 5' EXONUCLEASE

    • C. 

      POLYMERASE AND 5'-EXONUCLEASE

    • D. 

      3' and 5' EXONUCLEASE, plus POLYMERASE

  • 108. 
    The COMMON activities of DNA pol I and pol III are:
    • A. 

      POLYMERASE, 5' and 3' EXONUCLEASE

    • B. 

      POLYMERASE, 3' EXONUCLEASE

    • C. 

      POLYMERASE, 5' EXONUCLEASE

    • D. 

      POLYMERASE

  • 109. 
    The "PROOF-READER" activitiy of Pol I is its
    • A. 

      POLYMERASE activity

    • B. 

      5' EXONUCLEASE activity

    • C. 

      3' EXONUCLEASE activity

    • D. 

      ENDONUCLEASE activity

  • 110. 
    A HELICASE is characterized by:
    • A. 

      CUTS the DNA and RELIEVES supercoiling

    • B. 

      It is also a GYRASE

    • C. 

      UNWINDS DNA without cutting it

    • D. 

      Needs GTP for energy

  • 111. 
    The enzyme which REMOVES the RNA PRIMER from the OKAZAKI fragment is:
    • A. 

      Pol III

    • B. 

      KLENOW fragment

    • C. 

      PRIMASE

    • D. 

      Pol I

  • 112. 
    DNA pol III  REPLICATES the LAGGING strand by using
    • A. 

      A LOOP on the LAGGING strand

    • B. 

      By READING in the 5'-3' direction

    • C. 

      By using ONE enzyme per strand

    • D. 

      By moving BACKWARDS

  • 113. 
    The following are part of DNA REPLICATION in E. coli, EXCEPT
    • A. 

      OKAZAKI fragments

    • B. 

      OriC

    • C. 

      Ter LOCUS

    • D. 

      The PROMOTER

  • 114. 
    The TUS protein is a type of
    • A. 

      Gyrase

    • B. 

      Helicase

    • C. 

      Primase

    • D. 

      CONTRAhelicase

  • 115. 
    This ENZYME carries ITS OWN PRIMER
    • A. 

      REVERSE transcriptase

    • B. 

      Telomerase

    • C. 

      Prokaryotic pol III

    • D. 

      Primase

  • 116. 
    A GENE is a DNA SEQUENCE that encodes for:
    • A. 

      A protein

    • B. 

      RRNA

    • C. 

      T-RNA

    • D. 

      All of the above

  • 117. 
    In EUKARYOTES, mRNA is made by
    • A. 

      RNA Pol I

    • B. 

      RNA Pol II

    • C. 

      RNA Pol III

    • D. 

      RNA Pol σ (sigma)

  • 118. 
    The SITE  where RNA polymerase BINDS is the
    • A. 

      Promoter

    • B. 

      The starting site

    • C. 

      The OriC site

    • D. 

      The template

  • 119. 
    The CLOSE promoter COMPLEX is
    • A. 

      LOOSER than the OPEN promoter COMPLEX

    • B. 

      Form by RNA Pol CORE enzyme

    • C. 

      TIGHTER than the OPEN promoter COMPLEX

    • D. 

      None of the above

  • 120. 
    TRANSCRIPTION is finished by one of these subunits ***
    • A. 

      Delta

    • B. 

      Sigma

    • C. 

      Alpha

    • D. 

      Beta

  • 121. 
    A STRONG promoter is one that
    • A. 

      Is GC rich

    • B. 

      Is AT rich

    • C. 

      Has a SEQUENCE closest to CONSENSUS

    • D. 

      Has a WEAKLY bound OPEN complex

  • 122. 
    POSITIVE control of the LAC operon is ACHIEVED by:
    • A. 

      BINDING of the REPRESSOR to the OPERATOR

    • B. 

      BINDING of the INDUCER to the PROMOTER

    • C. 

      DETACHING of the REPRESSOR from the OPERATOR

    • D. 

      DETACHING of the INDUCER from the PROMOTER

  • 123. 
    In order to ACTIVATE the catabolite activator protein (CAP), it has to be
    • A. 

      Phosphorylated

    • B. 

      CAMP adenylated

    • C. 

      Glycosilated

    • D. 

      None of the above