Biochemistry 3 (Tests)

1. How many helical turns (the linking number) are found in a relaxed circular DNA of 4500 bp?

500

50

450

350

2. The linking number of a highly SUPERCOILED plasmid can be readily changed WITHOUT producing a relaxed DNA by:

Changing the TEMPERATURE

INCREASING the salt concentration

The action of TOPOISOMERASE

The action of a NUCLEASE such as pancreatic DNAse

3. In duplex DNA, how many hydrogen bonds does thymine use?

2

3

4

1

4. The nucleic acid that is unstable in ACID is

DNA

MRNA

RRNA

TRNA

5. A feature which is distinctive to Z-DNA is

A LEFT-HANDED helix

It has 12 BASES per turn

It is found IN VIVO

All of the above

6. Which of the following characteristic IS NOT associated with E. coli PRIMASE

It synthesizes the RNA PRIMER in DNA replication

It is a SPECIFIC RNA polymerase

It is ESSENTIAL for DNA replication

It is also a GYRASE

7. Which statement is INCORRECT about eh synthesis of RNA by RNA polymerase in E. coli?

A

B

8. A DNA is found to exhibit a melting temperature of 75 C in 0.1 M NaCl. Under what experimental conditions would the Tm be INCREASED?

DECREASING the concentration of DNA

INCREASING the concentration of NaCl in the solution

ADDING 1% urea (an organic denaturant)

All of the above

9. Which one of the following characteristics IS NOT associated with E. coli PRIMASE?

It is essential for DNA replication

It synthesizes the RNA primer in DNA replication

It is also a gyrase

It is a specific RNA polymerase

10. If you found a DNA molecule containing URACYL, the most probably CAUSE for it would be:

A mutation

A MISTAKE by the polymerase

A cytosine DEAMINATION

A probably ISOLATED RNA

11. When DNA is placed in dilute acid, it gets

Depurinated

Dephosphorylated

Annealed

Less active

12. The molecule that carries the pure genetic message in eukaryotes is:

Antisense DNA

MRNA

Sense DNA

HnRNA

13. A feature which is distinctive to Z-DNA is

A left-handed helix

It has 12 bases per turn

It is found in vivox

All of the above

14. The polymerase which plays a similar role as that of Prokaryotic Pol III in eukaryotic replication is (pg 1006)

DNA polymerase alpha

DNA polymerase delta

DNA polymerase alpha

15. Which item of experimental evidence gives the most support to the conclusion that "Every PURINE BASE pairs with a PYRIMIDINE BASE"

% of A = % of G

% of C = % of T

% of PURINES = % of PYRIMIDINE

16. The component (s) of DNA which is responsible for the absorbanc band at 250-270 nm is

Bases, pentoses, and phosphates all contribute

Only bases

Only bases and pentoses

Only pentoses and phosphates

17. All are true of the DNA double helix EXCEPT:

The strands are parallel

The strands are held by hydrogen bonds

The strands are complementary

The strands dissociate with high Urea

18. The RNA molecules which are involved in PROCESSING the hnRNA are

MRNA

TRNA

RRNA

SnRNA

19. A strain of E.coli produces the same high level of beta-galactosidase regardless of concentration of lactose in the medium. This strain most likely contains a deltion mutation int he gene (Note: you may assume that deletion mutation causes normal function

Lac I

Lac 2

Gene coding for the gamma-subunit of RNA polymerase

Gene encoding the catabolite activator protein

20. In the repair of DNA, the E.coli DNA polymerase involved performs which function in addition to its polymerase activity?

It recognizes the abnormality in the duplex DNA structure

It removes the damaged section of DNA with its 5'-3' exonuclease activity

It nicks DNA to provide a 3'-OH

It ligates the DNA after the repair synthesis

21. Which statement is INCORRECT about the STRUCTURE of native E. COLI chromosomal DNA?

The DNA is primarily in the BETA-helix

The DNA is CIRCULAR and SUPERCOILED

The DNA exists as a RIGHT-HANDED double helix

The DNA is one large LINEAR piece about 4000 kb in length

22. Why is a primer strand needed in DNA replication?

It insures the fidelity of the newly synthesized DNA strand

The DNA polymerases require a preexisting strand with a nucleotide having a 3'-OH.

The DNA polymerases require a preexisting strand with a nucleotide having a 5'-OH.

All of the above are correct

23. E. coli replication on the lagging strand (pg 1002)

Is primarily carried out by DNA polymerase I

Is synthesized continuously

This DNA strand is synthesized in a 3'-5' direction of synthesis

Is initially synthesized as Okazaki fragments

24. DNA pol III REPLICATES the LAGGING strand by using

A LOOP on the LAGGING strand

By READING in the 5'-3' direction

By using ONE enzyme per strand

By moving BACKWARDS

25. E. coli REPLICATION on the LAGGING strand

Is primarily carried out by DNA Polymerase I

Is synthesized CONTINUOUSLY

This DNA strand is synthesized int he 3'-5' direction of the synthesis

Is initially synthesized as OKAZAKI FRAGMENTS

26. DOUBLE-stranded RNA is found in?

Ribosomes

T-RNA

MRNA

RNA is NEVER double-stranded

27. The linking number of a highly supercoiled plasmid can be readily changed without producing a relaxed DNA by

Changing the temperature

Increasing salt concentration

The action of topoisomerase

The action of a nuclease such as pancreatic DNAse

28. Which one of the following characteristics ls not associated with E.coli primase?

It syntheslzes the RNA primer in DNA repllcation.

It is a specific RNA polymerase

It is essential for DNA replication

It is also a gyrase

29. Which IS NOT a property of E. coli DNA Polymerase III?

It is responsible for incorporating MOST of the NUCLEOTIDES in the LAGGING strand

It synthesizes MOST of the LEADING strand PRIOR to aiding in the synthesis of the LAGGING strand

It contains a 3'-5' EXONUCLEASE activity

It synthesizes the LEADING strand and the LAGGING strand at the SAME TIME

30. The Pribnow box is located

At -10 from the ENHANCER ELEMENT

At -10 bp from the INITIATION SITE

At -35 bp from the OPERATOR

At -35 bp from STARTING CODON

31. In eukaryotes, there are many MORE PROTEINS than GENES. This can be explained by

Association of proteins

Multiple subunites

Alternative splicing

Mutation

32. The KLENOW fragment of E. Coli DNA Polymerase I can be used to ADD nucleotides to a DNA WITHOUT staggered ends, IF THE ENDS...

Are RECESSED with 5'-phosphates

Are RECESSED with 3'-OHs

Are EXTENDED with 5'-phosphates

Are EXTENDED with 3'-OHs

33. In eukaryotic cells, the only RNA molecule which has a poly (A) tail attached to the 3' end is

MRNA

TRNA

SS RNA

All rRNA's

34. A DNA is found to exhibit a melting temperature of 75 degrees Celsius in 0.1M NaCl. Under what experimental conditions would the Tm be increased? (pg 372)

Decreasing the concentration of DNA

Increasing the concentration of NaCl in the solution

Adding 1% urea (an organic denaturant)

All of the above

35. INCREASE in gene expression in response to a METABOLITE is called:

Induction

Repression

Co-Induction

Co-Repression

36. A HELICASE is characterized by:

CUTS the DNA and RELIEVES supercoiling

It is also a GYRASE

UNWINDS DNA without cutting it

Needs GTP for energy

37. Which statement is INCORRECT about E. coli DNA Polymerase I?

The cells contain MORE MOLECULES of DNA pol I than DNA pol III

DNA pol I is a SINGLE POLYPEPTIDE with THREE domains

DNA pol I is involved in the REPAIR of UV-damaged DNA

DNA pol I has a LARGER TURNOVER number than DNA pol III

38. IN THE REPAIR of DNA, the E.coli DNA POLYMERASE involved performs which function IN ADDITION to its polymerase activity?

It RECOGNIZES the ABNORMALITY in the duplex DNA structure

It NICKS the DNA to provide a 3'-OH

It REMOVES the DAMAGED section of DNA with its 5'-3' EXONUCLEASE activity

It LIGATES the DNA after the REPAIR synthesis

39. One of the following is used for protein synthesis:

ATP

UTP

CTT

GTP

40. In order to ACTIVATE the catabolite activator protein (CAP), it has to be

Phosphorylated

CAMP adenylated

Glycosilated

None of the above

41. Telomerase is found in humans in

Somatic cells

Tumor cells

Senescent cells

Only found in prokaryotes

42. The reason why DNA is stable in BASE and RNA is not is because

RNA is single stranded

DNA is more basic

DNA is complexed with proteins

RNA has a 2-OH group

43. What is the primary role of the template strand in DNA replication?

It serves as the start point for the new DNA strand

It serves as a guide in determining the next nucleotide to be added by the polymerase

It increases the processivity of the DNA polymerase

It is essential for the 3-5' exonuclease activity

44. Why is a primer strand needed in DNA replication?

It insures the fidelity of the newly synthesized DNA strand

The DNA polymerases require a preexisting strand with a nucleotide having a 5'-OH

The DNA polymerases require a preexisting strand with a nucleotide having a 3'-OH

All of the above are correct

45. Which E. coli ENZYME has the GREATEST FREQUENCY of incorporating the INCORRECT NUCLEOTIDE into is nucleic acid POLYMER?

RNA polymerase

DNA polymerase I

DNA polymerase III

KLENOW fragment from DNA polymerase I

46. The TUS protein is a type of

Gyrase

Helicase

Primase

CONTRAhelicase

47. A GENE is a DNA SEQUENCE that encodes for:

A protein

RRNA

T-RNA

All of the above

48. E. coli DNA polymerase I has all of the following characteristics EXCEPT:

A 3'-5' EXONUCLEASE activity

A 5'-3' DNA polymerase activity

A 5'-3' EXONUCLEASE activity ON A SECOND subunit in the polymerase

MODEST processivity (20 nucleotides)

49. POSITIVE control of the LAC operon is ACHIEVED by:

BINDING of the REPRESSOR to the OPERATOR

BINDING of the INDUCER to the PROMOTER

DETACHING of the REPRESSOR from the OPERATOR

DETACHING of the INDUCER from the PROMOTER

50. Which E. coli enzyme has the greatest frequency of incorporating the incorrect nucleotide into its nucleic acid polymer?

RNA polymerase

DNA polymerase I

DNA polymerase III

Klenow fragment from DNA polymerase I

51. Pure DNA has an absorbance ratio of:

260/280 = 2.0

280/260 = 1.8

260/280 = 1.8

260/240 = 1.6

52. Which of the following characteristics is associated with the B form of DNA?

The sugars are located in the interior of the double helix

B

53. Which of the following IS NOT a characteristic for DNA synthesis?

DNA polymerase ADDS nucleotides in a 5'-3' direction

A PRIMER STRAND of DNA must contain a free 3'-OH end

The PRIMER STRAND of DNA DETERMINES which nucleotide are ADDED NEXT

The correct COMPLEMENTARY HYDROGEN BONDING between base pairs is the PRIMARY CHECK on the fidelity of the newly synthesized DNA

54. To what target sequence on DNA is the oligonucleotide pAATTCCGG complementary? (sequence are written as 5'-3')

TTAAGGCC

CCGGAATT

UUAAGGCC

CCGGAAUU

55. The RNA molecules which are involved in processing the hnRNA are

MRNA

TRNA

RRNA

SnRNA

56. Which of the following is not a characteristic for DNA synthesis?

DNA polymerase adds nucleotides in a 5' --> 3' direction

A primer strand of DNA must contain a free 3'-OH end

The primer strand of DNA determines which nucleotides are added next

The correct complementary hydrogen bonding between base pairs is the primary check on the fidelity of the newly synthesized DNA

57. Which of the following enzymes possesses a 5' to 3' exonuclease activity?

Primase

DNA polymerase I

DNA polymerase III

DNA gyrase

58. In eukaryotes, a DNA is found in:

The nucleus, ribosomes, and mitochondria

The nucleus, mitochondria, and chloroplasts

The nucleus, and mitochondria

The nucleus

59. The CLOSE promoter COMPLEX is

LOOSER than the OPEN promoter COMPLEX

Form by RNA Pol CORE enzyme

TIGHTER than the OPEN promoter COMPLEX

None of the above

60. Partial digestion of the oligonucleotide d-AGTACAA by pancreatic phosphodiesterase (a "b" cutter) would result in which set of products?

AGP, pAC, pAA

AGPp, AC, pAA

AGp, TAp, CAA

AG, TAp, pCCA

61. In the Sanger's DNA sequencing method, what is the reason for the stop of the chain elongation?

The dideoxynucleotide triphosphate (DTP)

The primer strand

The template strand has been synthesized with stops in it

One of the dNTPs

62. In the repair of DNA, the E.coli DNA polymerase invovled performs which function in addition to its polymerase activity?

It recognizes the abnormality in the duplex DNA structure.

It nicks the DNA to provide a 3'-OH

It removes the damaged section of DNA with its 5'-3' exonuclease activity

It ligates the DNA after the repair synthesis

63. Which statement is INCORRECT about the structure of native E.coli chromosomal DNA?

The DNA is primarily in the B-helix

The DNA is circular and supercoiled

The DNA exists as a right handed double helix

The DNA is one large linear piece about 4000 kb in length

64. An individual heterogeneous nuclear RNA (hnRNA)

Contains INTRON sequences not found in the final mature mRNA

Contains EXON sequences which are removed prior to translation

Encodes MORE THAN ONE protein

Can be found in the CYTOPLASM

65. The RNA Polymerase SLOWS down in

AT regions

Poly A regions

UA regions

GC regions

66. A STRONG promoter is one that

Is GC rich

Is AT rich

Has a SEQUENCE closest to CONSENSUS

Has a WEAKLY bound OPEN complex

67. In the RELAXED "B" DNA, one of these group of numbers is CORRECT:

W=0, L=20, T=20

W=20, L=20, T=0

T=20, L=20, W=40

L=40, W=20, T=20

68. The Klenow fragment of E. coli DNA polymerase I can be used to add nucleotides to a DNA with staggered ends if the ends...

Are recessed with 5'-phosphates

Are recessed with 3'-OHs

Are extended with 5'-phosphates

Are extended with 3'-OHs

69. TRANSCRIPTION is throught to generate

Positive supercoils BEHIND the transcription bubble

Positive supercoils IN FRONT of the transcription bubble

Negative supercoils IN FRONT of the transcription

A relaxed DNA during the transcription process

70. The following are part of DNA REPLICATION in E. coli, EXCEPT

OKAZAKI fragments

OriC

Ter LOCUS

The PROMOTER

71. Telomerase is an enzyme that (p 1008)

Decreases the size of the telomeres

Extends the 3' end of the telomeres lagging strand

It is not found in vertebrates

Uses a DNA primer to enxtend DNA

72. Which statement is incorrect about a typical E. coli promoter?

It consists of approximately 60 bp of dsDNA

It is recognized and bound by the gamma subunit of RNA polymerase holoenzyme

It contains a "GC rich" consensus sequence centered at -10 called the pribnow box

73. E. coli DNA POLYMERASE I has all of the following characteristics EXCEPT

A 5'-3' EXONUCLEASE activity on a SECOND subunit in the POLYMERASE

A 3'-5' EXONUCLEASE activity

A 5'-3' DNA POLYMERASE activity

MODEST processivity (20 nucleotides)

74. The genes for the enzymes needed int he synthetic pathway of a biomolecule usually are found int he form of

Gene families

An operon

Housekeeping genes

Oncogenes

75. The POLYMERASE IN EUKARYOTIC REPLICATION which plays a similar role as that of PROKARYOTIC'S Polymerase III is?

DNA Polymerase γ (gamma)

DNA Polymerase δ (delta)

DNA Polymerase σ (sigma)

DNA Polymerase α (alpha)

76. The SITE where RNA polymerase BINDS is the

Promoter

The starting site

The OriC site

The template

77. The COMMON activities of DNA pol I and pol III are:

POLYMERASE, 5' and 3' EXONUCLEASE

POLYMERASE, 3' EXONUCLEASE

POLYMERASE, 5' EXONUCLEASE

POLYMERASE

78. Which one of the following DNA sequences is palindromic?

GCGCGCGCGCGC/ CGCGCGCGCGCG

GGGGGGGGCGA/ CCCCCCCCGCC

ATGCATGC/ TACGTACG

GGCCGGCCGG/ CCGGCCGGCC

79. Which statement is INCORRECT about E. coli DNA polymerase I? (pg 991)

The cell contains more molecules of DNA pol I than DNA pol III

DNA pol I is a single polypeptide with three domains

DNA pol I is involved in the repair of UV damaged DNA

DNA pol I has a larger turnover number than DNA pol III

80. The oligonucleotide, AUGGp, has all these properties, EXCEPT

Composed of ribonucleotides

Contains a 3' phosphate

Composed of deoxyribonucleotides

Contains three phosphodiester bonds

81. Since the HEPTAPEPTIDE repeats (in the carboxy terminal domain located in the large subunit of RNA Polymerase II) can be phosphorylated, the repeats must contain:

Serine

Aspartic Acid

Histidine

Tryptophan

82. Which statement is INCORRECT about E. coli DNA ligase?

It functions int he replication but not in the repair of DNA

It forms a "DNA-AMP" covalent complex during the reaction it catalyzes

It catalyzes the formation of a phosphoester bond in dsDNA

83. LEUCINE is coded by 6 different codons, this represents

Degeneracy

Synonymous codons

Unambiguous codons

All of the above

84. If snake venon phosphodiesterase (3' - "a" cutter) cleaved the molecule above, what fragments would you expect as a result

PG, pATAC

PGp, ATAC

PGATA, pC

PGATAp, C

85. T-RNA (Met) and t-RNA (fMet)

Can recognize the AUG codon

Are the same t-RNA but with different amino acids

Are used by eukaryotes and prokaryotes

None of the above

86. Which is not a property of E.coli DNA polymerase III?

It is responsible for incorporating most of the nucleotides in the lagging strand

It synthesizes most of the leading strand prior to aiding in the synthesis of the lagging strand

It contains a 3' to 5' exonuclease activity

It synthesizes the leading strand and the lagging strand at the same time

87. The term "upstream" means (p 1019)

Any place int he DNA after the promoter site

Any place in the DNA at the noncoding region

A consensus sequence that goes from 3' to 5'

Any region in the DNA that is closer to the 5' end

88. Which of the following IS NOT a characteristic of REPLICATION of the E.coli CIRCULAR chromosome?

Replication is BIDIRECTIONAL

It INITIATES at a unique position called oriC

TORSIONAL STRESS introduced in the duplex DNA is relieved by DNA GYRASE

The UNWINDING of the duplex DNA is driven by the TRANSLOCATION of the DNA Polymerase

89. Which of the following statements is incorrect when dsDNA is denatured? (pg 371-2)

The absorbance at 260 decreases about 40%

The hgiher the G+C content, the higher the melting temperature

The transition from dsDNA to ssDNA is highly cooperative

The fraction of DNA that is single stranded is 0.5 at its Tm

90. The KLENOW fragment has the following activities

POLYMERASE and 3'-EXONUCLEASE

3' and 5' EXONUCLEASE

POLYMERASE AND 5'-EXONUCLEASE

3' and 5' EXONUCLEASE, plus POLYMERASE

91. The Klenow fragment from E.coli DNA polymerase contains all of the following except (pg 993)

DNA polymerase activity

5'-3' exonuclease activity

The large fragment from the C-terminal end of the polymerase

3'-5' exonuclease activity

92. This ENZYME carries ITS OWN PRIMER

REVERSE transcriptase

Telomerase

Prokaryotic pol III

Primase

93. In dsDNA the direction of the strand is

Both are 5'-3'

One is 5'-3' and other is 3'-5'

Both are 3'-5'

None of the above

94. Under which of the following conditions does the melting temperature for the denaturation of duplex DNA decrease?

Higher salt concentration in the buffer

Higher GC content in the DNA

PH higher than 10 in the buffer

Longer DNA fragments

95. In EUKARYOTES, mRNA is made by

RNA Pol I

RNA Pol II

RNA Pol III

RNA Pol σ (sigma)

96. Which of the following factors or subunits is contained within the core RNA polymerase in prokaryotic organisms? (pg 1016)

Alpha, beta, and beta'

Alpha, beta, beta', and gamma holoenzyme

TFIID, SP1 and enhancer protein

TF IIIA, TFIIIB, and TFIIIC

97. Prokaryotic genes have conserved DNA sequences centered around -10 and -35 before the initiation point of transcription. THese regions contain a binding site for:

The rho protein

DNA polymerase

Ribosomes

RNA polymerase holoenzyme

98. The reason why DNA does not contain uracyl is because

Uracyl forms unstable hydrogen bonds

Cytosine spontaneously becomes uracyl

Thymine can do the same function as uracyl

Uracyl can only from glycosidic bonds with ribose

99. What statement is INCORRECT about the different RNA molecules?

TRNA contains numerous intramolecular HYDROGEN BONDS between bases

There are MORE DISTINCT tRNA molecules than there are rRNA molecules

RRNA are complexed to PROTEINS in the ribosome

The MOST ABUNDANT RNA molecule in the cell is mRNA

100. One of these codons is likely to code for NON-POLAR amino acid

GUU

GAC

GGG

GAA

101. In eukaryotic translation

The t-RNA (Met) is used for INITIATION and ELONGATION

The t-RNA (Met) is used for INITIATION only

Is INITIATED with t-RNA (fMet)

There are two separate t-RNA (Met) used for INITIATION and ELONGATION

102. Which statement is CORRECT about RNA polymerase in E. coli?

It transcribes the DNA sense strand

It transcribes the DNA antisense strand

It transcribes only protein genes

It translates DNA into protein

103. In the processing of the Okazaki fragments into a continuous DNA strand in E. coli, which of the following enzyme activity IS NOT required?

Polymerase I

Ligase

RNA-H

DNAse

104. Which of the following double-stranded DNAs may convert to a cruciform structure?

ATGCATGCATGCATGC/ TACGTACGTACGTACG

AAAAAAAAACCCCCCCCC/ TTTTTTTTTGGGGGGGGC

ATATATATGCGCGCGCGC/ TATATATACGCGCGCGCG

CATTAAGCAGTGCTTAAGA/ GAATTCGTCACGAATTCT

105. In the Sanger's DNA sequencing method of the following oligonucleotide, what will be the sequence read form the gel? AATCGATTCGGGCTATA. The primer is 4 nucleotides long. (pg 359)

AATCGATTCGGGCTATA

TTAGCTAAGCCCGATAT

The primer strand plus TTAGCTAAGCCCG

TTAGCTAAGCCCG

106. The enzyme which REMOVES the RNA PRIMER from the OKAZAKI fragment is:

Pol III

KLENOW fragment

PRIMASE

Pol I

107. The "PROOF-READER" activitiy of Pol I is its

POLYMERASE activity

5' EXONUCLEASE activity

3' EXONUCLEASE activity

ENDONUCLEASE activity

108. An enzyme that changes the shape of supercoiled DNA without changing its linking number is (pg 376 or 576)

Gyrase

Topoisomerase II

Helicase

Topoisomerase I

109. A strain of E. coli produces the same high level of beta-galactosidase regardless of the concentration of lactose in the medium. This strain most liekly contains a deletion mutation in the gene (Note: you may assume that the deletion mutation causes loss of normal function) (pg 10)

Lac 1

Lac 2

Gene coding for the gamma-subunit of RNA polymerase

Gene encoding the catabolite activator protein

110. DNA-DEPENDENT RNA polymerase acts on the DNA template in EUKARYOTIC CELLS in the SYNTHESIS of:

A 5'-3' hnRNA TRANSCRIPT as the RNA polymerase moves in the 3'-5' direction on the DNA template

A mature RNA transcript a the RNA polymerase moves in the 5'-3' direction

An RNA transcript, with the SIGMA subunit of polymerase DISSOCIATING after the initiation event

111. The lac operon includes (pg 1031)

The structural genes for lacZ, lacY, and lacA

The three structural genes listed in (a) and the operator and promoter sequences for these genes

All elements listed in (b) and the lacI gene

All elements in (c) and the promoter for lacI

112. Which statemnt is INCORRECT aobut enhancer sequences in eukaryotes (pg 1015)

They can occur within a gene

They can occur either 3' or 5' to the gene

They can be in either orientation

They can be placed at different distances from the gene without changing their influence

113. Which statement is INCORRECT about a typical E. coli promoter? (pg 1019)

It consists of approximately 60 bp of dsDNA

It is recognized and bound by the gamma-subunit of RNA polymerase holoenzyme

It contains a "GC rich" consensus seuqence centered at =10 called the Pribnow box

114. Which polymerase has the highest processivity?

DNA Polymerase III

DNA Polymerase gamma

DNA Polymerase delta

115. The promoter site is

The start base for transcription in DNA

The binding site in DNA for regulatory proteins which stimulate or further promote the level of transcription

The site on DNA at which RNA polymerase binds to initiate transcription

The general region of DNA downstream from the start site.

116. The synthesis of the DNA strand is thermodynamically driven by

The dNTP hydrolysis to produce the incorporated NMP and the PPi

The nature of the strong connecting bonds formed int he linked nucleotides

The dNTP hydrolysis and the subsequent hydrolysis of PPi by pyrophosphatase

The inherent stability of the synthesized DNA polynucleotide

117. RNA polymerase II (pg 102)

Is located int he nucleolus and transcribes the major ribosomal RNA genes

Is located in the nucleoplasm (general nucleus) and transcribes protein-encoding genes

Transcribes the 5S RNA genes

Transcribes RNAs associated with mRNA processing (SNRP's)

118. Which statement is INCORRECT about RNA polymerase in E. coli?

It does not contain a 3' or 5' exonuclease activity

Its holoenzyme contains four different subunits organized as alpha beta beta prime, gamma

It synthesizes mRNA, tRNA, rRNA as well as the RNA primers during replication

It uses the nucleotides UTP, GTP, ATP, and CTP as substrates

119. The subunit involved in melting dsDNA in RNA polymerase is

α (alpha)

γ (gamma)

σ (sigma)

δ (delta)

120. Which E. coli DNA polymerase is responsible for the repair of DNA?

DNA polymerase I

Klenow fragment

DNA polymerase II

DNA polymerase III

121. TRANSCRIPTION is finished by one of these subunits ***

Delta

Sigma

Alpha

Beta

122. Which of the following double-stranded DNAs may convert to a cruciform structure?

ATGCATGCATGCATGCACGTACGTACGTACG

ATATATATGCGCGCGCGCTATATATACGCGCGCGCG

CATTAAGCAGTGCTTAAGAGTAATTCGTCACGAATTCT

AAAAAAAAACCCCCCCCTTTTTTTTTGGGGGGGG

123. The subunit in E. coli RNA polymerase which is required fro recognition of the promoter sequence is

Alpha

Beta

Beta prime

Gamma

Biochemistry 3 (Tests)

1. How many helical turns (the linking number) are found in a relaxed circular DNA of 4500 bp?

2.

What first name or nickname would you like us to use?

2. The linking number of a highly SUPERCOILED plasmid can be readily changed WITHOUT producing a relaxed DNA by:

3. In duplex DNA, how many hydrogen bonds does thymine use?

4. The nucleic acid that is unstable in ACID is

5. A feature which is distinctive to Z-DNA is

6. Which of the following characteristic IS NOT associated with E. coli PRIMASE

7. Which statement is INCORRECT about eh synthesis of RNA by RNA polymerase in E. coli?

8. A DNA is found to exhibit a melting temperature of 75 C in 0.1 M NaCl. Under what experimental conditions would the Tm be INCREASED?

9. Which one of the following characteristics IS NOT associated with E. coli PRIMASE?

10. If you found a DNA molecule containing URACYL, the most probably CAUSE for it would be:

11. When DNA is placed in dilute acid, it gets

12. The molecule that carries the pure genetic message in eukaryotes is:

13. A feature which is distinctive to Z-DNA is

14. The polymerase which plays a similar role as that of Prokaryotic Pol III in eukaryotic replication is (pg 1006)

15. Which item of experimental evidence gives the most support to the conclusion that "Every PURINE BASE pairs with a PYRIMIDINE BASE"

16. The component (s) of DNA which is responsible for the absorbanc band at 250-270 nm is

17. All are true of the DNA double helix EXCEPT:

18. The RNA molecules which are involved in PROCESSING the hnRNA are

19. A strain of E.coli produces the same high level of beta-galactosidase regardless of concentration of lactose in the medium. This strain most likely contains a deltion mutation int he gene (Note: you may assume that deletion mutation causes normal function

20. In the repair of DNA, the E.coli DNA polymerase involved performs which function in addition to its polymerase activity?

21. Which statement is INCORRECT about the STRUCTURE of native E. COLI chromosomal DNA?

22. Why is a primer strand needed in DNA replication?

23. E. coli replication on the lagging strand (pg 1002)

24. DNA pol III REPLICATES the LAGGING strand by using

25. E. coli REPLICATION on the LAGGING strand

26. DOUBLE-stranded RNA is found in?

27. The linking number of a highly supercoiled plasmid can be readily changed without producing a relaxed DNA by

28. Which one of the following characteristics ls not associated with E.coli primase?

29. Which IS NOT a property of E. coli DNA Polymerase III?

30. The Pribnow box is located

31. In eukaryotes, there are many MORE PROTEINS than GENES. This can be explained by

32. The KLENOW fragment of E. Coli DNA Polymerase I can be used to ADD nucleotides to a DNA WITHOUT staggered ends, IF THE ENDS...

33. In eukaryotic cells, the only RNA molecule which has a poly (A) tail attached to the 3' end is

34. A DNA is found to exhibit a melting temperature of 75 degrees Celsius in 0.1M NaCl. Under what experimental conditions would the Tm be increased? (pg 372)

35. INCREASE in gene expression in response to a METABOLITE is called:

36. A HELICASE is characterized by:

37. Which statement is INCORRECT about E. coli DNA Polymerase I?

38. IN THE REPAIR of DNA, the E.coli DNA POLYMERASE involved performs which function IN ADDITION to its polymerase activity?

39. One of the following is used for protein synthesis:

40. In order to ACTIVATE the catabolite activator protein (CAP), it has to be

41. Telomerase is found in humans in

42. The reason why DNA is stable in BASE and RNA is not is because

43. What is the primary role of the template strand in DNA replication?

44. Why is a primer strand needed in DNA replication?

45. Which E. coli ENZYME has the GREATEST FREQUENCY of incorporating the INCORRECT NUCLEOTIDE into is nucleic acid POLYMER?

46. The TUS protein is a type of

47. A GENE is a DNA SEQUENCE that encodes for:

48. E. coli DNA polymerase I has all of the following characteristics EXCEPT:

49. POSITIVE control of the LAC operon is ACHIEVED by:

50. Which E. coli enzyme has the greatest frequency of incorporating the incorrect nucleotide into its nucleic acid polymer?

51. Pure DNA has an absorbance ratio of:

52. Which of the following characteristics is associated with the B form of DNA?

53. Which of the following IS NOT a characteristic for DNA synthesis?

54. To what target sequence on DNA is the oligonucleotide pAATTCCGG complementary? (sequence are written as 5'-3')

55. The RNA molecules which are involved in processing the hnRNA are

56. Which of the following is not a characteristic for DNA synthesis?

57. Which of the following enzymes possesses a 5' to 3' exonuclease activity?

58. In eukaryotes, a DNA is found in:

59. The CLOSE promoter COMPLEX is

60. Partial digestion of the oligonucleotide d-AGTACAA by pancreatic phosphodiesterase (a "b" cutter) would result in which set of products?

61. In the Sanger's DNA sequencing method, what is the reason for the stop of the chain elongation?

62. In the repair of DNA, the E.coli DNA polymerase invovled performs which function in addition to its polymerase activity?

63. Which statement is INCORRECT about the structure of native E.coli chromosomal DNA?

64. An individual heterogeneous nuclear RNA (hnRNA)

65. The RNA Polymerase SLOWS down in

66. A STRONG promoter is one that

67. In the RELAXED "B" DNA, one of these group of numbers is CORRECT:

68. The Klenow fragment of E. coli DNA polymerase I can be used to add nucleotides to a DNA with staggered ends if the ends...

69. TRANSCRIPTION is throught to generate

70. The following are part of DNA REPLICATION in E. coli, EXCEPT

71. Telomerase is an enzyme that (p 1008)

72. Which statement is incorrect about a typical E. coli promoter?

73. E. coli DNA POLYMERASE I has all of the following characteristics EXCEPT

74. The genes for the enzymes needed int he synthetic pathway of a biomolecule usually are found int he form of

75. The POLYMERASE IN EUKARYOTIC REPLICATION which plays a similar role as that of PROKARYOTIC'S Polymerase III is?

76. The SITE where RNA polymerase BINDS is the

77. The COMMON activities of DNA pol I and pol III are: