Biology Practice Test (Part 2)

  • 10th Grade,
  • 11th Grade,
  • 12th Grade
  • NGSS
  • AP Bio
Reviewed by Editorial Team
The ProProfs editorial team is comprised of experienced subject matter experts. They've collectively created over 10,000 quizzes and lessons, serving over 100 million users. Our team includes in-house content moderators and subject matter experts, as well as a global network of rigorously trained contributors. All adhere to our comprehensive editorial guidelines, ensuring the delivery of high-quality content.
Learn about Our Editorial Process
| By Nokee
N
Nokee
Community Contributor
Quizzes Created: 3 | Total Attempts: 504
| Attempts: 173 | Questions: 50 | Updated: Aug 23, 2025
Please wait...
Question 1 / 51
🏆 Rank #--
0 %
0/100
Score 0/100

1. The function of the promoter is to signal the RNA polymerase where to stop transcribing the DNA

Explanation

The given statement is false. The function of the promoter is to signal the RNA polymerase where to start transcribing the DNA, not where to stop. The promoter is a specific sequence of DNA that is located upstream of the gene being transcribed. It provides a binding site for the RNA polymerase, allowing it to recognize the start site for transcription and initiate the process.

Submit
Please wait...
About This Quiz
Biology Practice Test (Part 2) - Quiz

This Biology Practice Test (part 2) assesses understanding of key concepts such as kinetic energy in biology, entropy, cellular energy sources, anaerobic glucose metabolism, and ATP production in glycolysis. Ideal for students enhancing knowledge in cellular processes.

2.

What first name or nickname would you like us to use?

You may optionally provide this to label your report, leaderboard, or certificate.

2. Allosterc sites of enzymes are the same as the active sites of the enzymes

Explanation

The statement is false because the allosteric sites of enzymes are different from the active sites of the enzymes. The active site is the specific region of the enzyme where the substrate binds and the chemical reaction takes place. On the other hand, the allosteric site is a different region of the enzyme where molecules other than the substrate can bind and regulate the enzyme's activity. These allosteric sites can either activate or inhibit the enzyme's function, and they are distinct from the active site.

Submit

3. In the lactase lab, the lactose was present in the milk

Explanation

The lactase lab involved the presence of lactose in the milk. This suggests that the purpose of the lab was to test the enzyme lactase's ability to break down lactose. Lactose is a sugar found in milk, and lactase is the enzyme responsible for breaking it down into its component sugars, glucose and galactose. Therefore, it is logical to conclude that lactose was indeed present in the milk used in the lab.

Submit

4. The start codon can be the code for any of the 20 amino acids

Explanation

The start codon is a specific sequence of nucleotides that signals the beginning of protein synthesis. It is always the code for the amino acid methionine and not any of the other 20 amino acids. Therefore, the statement that the start codon can be the code for any of the 20 amino acids is false.

Submit

5. Pick the best choice for the following statement about DNA: Like a spiral staircase

Explanation

The correct answer is "Double helix A" because the statement "Like a spiral staircase" is referring to the structure of DNA, which is a double helix. The double helix structure is formed by two strands of DNA that are twisted together, resembling a spiral staircase. The other options, such as deoxyribose, phosphate, covalent bonds, and hydrogen bonds, are all components or types of bonds found within the DNA molecule, but they do not directly relate to the spiral staircase-like structure.

Submit

6. In the chromatography lab, you separated the spinach’s ------on a filter paper

Explanation

In the chromatography lab, the purpose is to separate different components of a mixture based on their solubility and affinity for the stationary phase. In this case, the question mentions that the spinach's something was separated on a filter paper. Chromatography is commonly used to separate pigments, such as chlorophyll, which are present in spinach. Therefore, the correct answer is pigments.

Submit

7. An _________ chemical reaction releases energy while an __________ reactions requires an input of energy

Explanation

Exergonic reactions release energy, meaning that the products have less energy than the reactants. On the other hand, endergonic reactions require an input of energy, meaning that the products have more energy than the reactants. Therefore, the correct answer is exergonic; endergonic.

Submit

8. What results if glucose is metabolized under completely anaerobic conditions?

Explanation

When glucose is metabolized under completely anaerobic conditions, pyruvic acid is converted by fermentation into either CO2 and ethanol or lactic acid. This is because in the absence of oxygen, the cells cannot undergo aerobic respiration and instead rely on fermentation to generate energy. Fermentation allows for the regeneration of NAD+ so that glycolysis can continue, producing either ethanol or lactic acid as byproducts depending on the organism.

Submit

9. Which of the following is part of the first law of thermodynamics

Explanation

The first law of thermodynamics, also known as the law of conservation of energy, states that energy cannot be created or destroyed, only converted from one form to another. This means that the total amount of energy in a closed system remains constant. This principle is fundamental in understanding energy transfer and transformation in various physical and chemical processes.

Submit

10. What kind of mutation occurs when one base is changed to another at a single location in the DNA

Explanation

A substitution mutation occurs when one base is changed to another at a single location in the DNA. This means that one nucleotide is replaced by a different nucleotide, which can result in a change in the amino acid sequence during protein synthesis. Substitution mutations can have different effects depending on the specific nucleotide change and its location within the DNA sequence.

Submit

11. In the lab, when observing the mesophyll cells of Alodea under the microscope, you saw many

Explanation

While observing the mesophyll cells of Alodea under the microscope, the presence of various organelles was noted. Among these organelles, the correct answer is "chloroplasts." Chloroplasts are responsible for photosynthesis in plant cells, where they convert sunlight into energy-rich molecules. The other options mentioned, such as amyloplasts, sphingoplasts, leucoplasts, and teichoplasts, are not involved in photosynthesis and do not play a role in capturing sunlight.

Submit

12. If the sequence of bases in a section of DNA is TAGGCTAA, what is the corresponding sequence of bases in mRNA?

Explanation

The corresponding sequence of bases in mRNA can be found by replacing each base in the DNA sequence with its complementary base in RNA. In DNA, adenine (A) pairs with thymine (T), guanine (G) pairs with cytosine (C), and vice versa. Therefore, in the given DNA sequence TAGGCTAA, the complementary RNA sequence would be AUCCGAUU.

Submit

13. The process of copying genetic information from DNA to RNA is called

Explanation

The process of copying genetic information from DNA to RNA is called transcription. During transcription, an enzyme called RNA polymerase binds to a specific region of DNA called the promoter and separates the DNA strands. It then uses one of the DNA strands as a template to synthesize a complementary RNA molecule. This RNA molecule is an exact copy of the DNA sequence, except that it contains uracil (U) instead of thymine (T). Transcription is an essential step in gene expression, as it allows the genetic information stored in DNA to be used for protein synthesis.

Submit

14. The majority of the leaf’s chloroplasts are found in the mesophyll cells.

Explanation

The mesophyll cells are responsible for photosynthesis in plants, as they contain the majority of the leaf's chloroplasts. Chloroplasts are the organelles where photosynthesis takes place, and they contain the pigment chlorophyll that captures sunlight and converts it into energy. Therefore, it is true that the majority of the leaf's chloroplasts are found in the mesophyll cells.

Submit

15. Enzyme activity is influenced by

Explanation

Enzyme activity is influenced by pH, temperature, and salt concentration. pH affects the ionization state of amino acid residues in the enzyme's active site, which can alter its activity. Temperature affects the rate of enzyme-catalyzed reactions, with higher temperatures generally increasing activity until a certain point where the enzyme denatures. Salt concentration can also affect enzyme activity by altering the ionic strength of the solution, which can impact the stability and conformation of the enzyme. Therefore, all three factors, pH, temperature, and salt concentration, can have an influence on enzyme activity.

Submit

16. Which of the following has the greatest amount of kinetic energy?

Explanation

The flying bird has the greatest amount of kinetic energy because kinetic energy is the energy possessed by an object due to its motion. The bird is in motion while flying, therefore it has more kinetic energy compared to the other options. The tank of gasoline, parked car, and cool air surrounding the engine are not in motion, so they have less or no kinetic energy.

Submit

17. What is the ultimate source of energy for most forms of life on Earth?

Explanation

Solar energy is the ultimate source of energy for most forms of life on Earth. This is because sunlight is captured by plants through the process of photosynthesis, which converts solar energy into chemical energy in the form of glucose. This glucose is then used by plants as a source of energy for growth and development. Other organisms, such as herbivores and carnivores, obtain their energy by consuming plants or other animals that have obtained their energy from the sun. Therefore, solar energy is the primary source of energy that sustains life on Earth.

Submit

18. The most ATP is produces during which of the following processes

Explanation

The electron transport chain is the process that produces the most ATP. This is because it is the final step in cellular respiration, where the majority of ATP is generated. During the electron transport chain, electrons from NADH and FADH2 are passed along a series of protein complexes, creating a proton gradient across the inner mitochondrial membrane. This gradient is then used by ATP synthase to produce ATP. In contrast, glycolysis and the Krebs cycle produce a smaller amount of ATP compared to the electron transport chain.

Submit

19. The most common energy carrier molecule of living organisms is

Explanation

ATP (adenosine triphosphate) is the most common energy carrier molecule in living organisms. It is responsible for storing and releasing energy for various cellular processes. ATP is composed of adenosine and three phosphate groups. When one phosphate group is removed from ATP, it releases energy, which can be used by cells for activities such as muscle contraction, active transport, and synthesis of molecules. In contrast, inorganic phosphate, DNA, glucose, and GADPH do not serve as energy carrier molecules in the same way as ATP does.

Submit

20. Semiconservative DNA replication means

Explanation

Semiconservative DNA replication refers to the process in which each new DNA molecule formed during replication contains one strand from the original DNA molecule and one newly synthesized strand. This means that half of the old DNA molecule is conserved in each new DNA molecule, while the other half is newly synthesized. This process ensures the preservation of genetic information during DNA replication.

Submit

21. Which of these is found in RNA but NOT in DNA?

Explanation

Uracyl is found in RNA but not in DNA. RNA is a single-stranded molecule that contains uracil instead of thymine, which is found in DNA. Uracil replaces thymine in RNA and pairs with adenine during RNA synthesis. This difference in nucleotide composition is one of the key distinctions between RNA and DNA.

Submit

22. During glycolysis, what is the net gain of ATP molecules produced?

Explanation

During glycolysis, which is the first step of cellular respiration, the net gain of ATP molecules produced is 2. This occurs through substrate-level phosphorylation, where a phosphate group is transferred from a substrate molecule to ADP, forming ATP. Glycolysis breaks down glucose into two molecules of pyruvate, and during this process, a total of 4 ATP molecules are produced. However, 2 ATP molecules are consumed in the initial steps of glycolysis, resulting in a net gain of 2 ATP molecules.

Submit

23. Which of the following has potential energy?

Explanation

All of the given options have potential energy. The water droplet on top of a waterfall has potential energy due to its position in the Earth's gravitational field. The glucose molecule has potential energy stored in its chemical bonds. The diver on a springboard has potential energy due to their position above the ground. The 9V battery has potential energy stored in its chemical composition. Therefore, all of the options listed have the potential to do work or release energy in some form.

Submit

24. Complementary base pairs are held together by

Explanation

Complementary base pairs in DNA are held together by hydrogen bonds. These bonds form between specific pairs of nucleotides: adenine (A) pairs with thymine (T) and guanine (G) pairs with cytosine (C). Hydrogen bonds are relatively weak compared to covalent bonds, but they provide enough stability to maintain the structure of the DNA double helix. This allows for the replication and transcription of DNA, as well as the accurate transmission of genetic information.

Submit

25. The strand of the DNA molecule that is used to transcribe from is called the _______ strand

Explanation

The template strand is the correct answer because it is the strand of DNA that serves as a template for the synthesis of RNA during transcription. The RNA molecule is complementary to the template strand, with each nucleotide in the RNA being dictated by the corresponding nucleotide in the template strand. This process allows for the accurate transfer of genetic information from DNA to RNA.

Submit

26. Entropy is a measure of

Explanation

Entropy is a measure of the randomness or disorder in a system. As entropy increases, the system becomes more disordered and unpredictable. This is because there are more possible arrangements or configurations for the particles or components within the system. Conversely, as entropy decreases, the system becomes more ordered and predictable. Therefore, the correct answer is "increase in randomness".

Submit

27. What factors influence the rate of photsynthesis?

Explanation

All of these factors influence the rate of photosynthesis. Light intensity is important because it provides the energy needed for the process. Temperature affects the rate of photosynthesis because enzymes involved in the process have an optimal temperature range. CO2 is a necessary reactant for photosynthesis, and its availability affects the rate. Water availability is also crucial as it is needed for the transport of nutrients and for maintaining turgidity in plant cells, which is necessary for photosynthesis.

Submit

28. The sequence of subunits in the DNA “backbone” is

Explanation

The correct answer is "-phosphate—sugar—phosphate—sugar—phosphate—sugar-". This is because the DNA backbone consists of alternating sugar and phosphate molecules. The phosphate group is attached to the 5' carbon of one sugar molecule and the 3' carbon of the adjacent sugar molecule. The sugar molecule in DNA is deoxyribose, and the phosphate group is a phosphodiester bond. This alternating arrangement of sugar and phosphate molecules forms the backbone of the DNA molecule.

Submit

29. When DNA polymerase is in contact with thymine in the parental strand, what does it add to the growing daughter strand?

Explanation

When DNA polymerase is in contact with thymine in the parental strand, it adds adenine to the growing daughter strand. This is because adenine forms a complementary base pair with thymine. In DNA replication, the DNA polymerase synthesizes a new strand by adding nucleotides that are complementary to the bases in the parental strand. Thymine always pairs with adenine, while cytosine pairs with guanine. Therefore, when DNA polymerase encounters thymine in the parental strand, it adds adenine to the growing daughter strand.

Submit

30. Chemiosmosis in mitochondria directly results in the synthesis of

Explanation

Chemiosmosis in mitochondria is a process where ATP is synthesized. During this process, the electron transport chain pumps protons across the inner mitochondrial membrane, creating an electrochemical gradient. This gradient drives the movement of protons back into the mitochondrial matrix through ATP synthase, an enzyme that synthesizes ATP. As protons flow through ATP synthase, it catalyzes the addition of a phosphate group to ADP, forming ATP. Therefore, the correct answer is ATP.

Submit

31. Imagine you are conducting an experiment on a yeast enzyme known as sucrase  This enzyme is used by yeast cells to break sucrose into glucose and fructose.  What type of reaction is this?

Explanation

This reaction is an exergonic reaction because it releases energy. Sucrase breaks down sucrose into glucose and fructose, and this process releases energy.

Submit

32. When a cell divides

Explanation

During cell division, each daughter cell receives a nearly perfect copy of the parent cell's genetic information. This is because the genetic material is replicated before the cell divides, ensuring that each daughter cell receives an identical set of chromosomes. This process is crucial for maintaining genetic stability and ensuring the accurate transmission of genetic information from one generation to the next.

Submit

33. Both plants and animals perform

Explanation

Plants and animals both perform glycolysis, fermentation, and the Krebs cycle. Glycolysis is the initial step in cellular respiration, where glucose is broken down to produce energy. Fermentation is an anaerobic process that occurs when oxygen is not available, and it helps regenerate NAD+ for glycolysis to continue. The Krebs cycle, also known as the citric acid cycle, is the second stage of cellular respiration where acetyl-CoA is oxidized to produce ATP, NADH, and FADH2. Therefore, all three processes are essential for energy production in both plants and animals.

Submit

34. The number of consecutive mRNA bases needed to specify an amino acid is

Explanation

The number of consecutive mRNA bases needed to specify an amino acid is 3. This is because each amino acid is coded by a sequence of three mRNA bases called a codon. There are a total of 64 possible codons (4^3), which can code for the 20 different amino acids found in proteins, as well as the start and stop signals for protein synthesis. Therefore, three consecutive mRNA bases are required to accurately specify an amino acid.

Submit

35. The reactant in an enzyme-catalyzed reaction is the

Explanation

In an enzyme-catalyzed reaction, the reactant that undergoes a chemical transformation is called the substrate. Enzymes are specialized proteins that act as catalysts, increasing the rate of chemical reactions by lowering the activation energy required for the reaction to occur. The substrate binds to the active site of the enzyme, forming an enzyme-substrate complex. This allows the enzyme to facilitate the conversion of the substrate into the desired product. Therefore, the correct answer is substrate.

Submit

36. Erythrpoietin (EPO) stimulates which of the following processes

Explanation

Erythropoietin (EPO) is a hormone that stimulates the production of red blood cells in the body. Red blood cells are responsible for carrying oxygen to different parts of the body. Therefore, EPO plays a crucial role in maintaining the oxygen-carrying capacity of the blood. The other options listed, such as NaCl uptake, adjustment of blood pH, white blood cell production, and NaCl release into the urine, are not directly regulated by EPO.

Submit

37. Which of the following processes occur(s) in the cytoplasm?

Explanation

Glycolysis is the process of breaking down glucose into pyruvate molecules. It occurs in the cytoplasm of cells. The Krebs Cycle and the electron transport chain (ETC) occur in the mitochondria, not in the cytoplasm. Therefore, the correct answer is Glycolysis.

Submit

38. If a bacterial protein has 30 amino acids, how many nucleotides are needed to code for it?

Explanation

Each amino acid is coded for by a sequence of three nucleotides called a codon. Therefore, to code for a protein with 30 amino acids, we need 30 codons. Since each codon consists of three nucleotides, we need a total of 30 x 3 = 90 nucleotides to code for the protein.

Submit

39.  Specifically, molecules of chlorophyll are located in membranes of sacs called

Explanation

Thylakoids are the correct answer because they are membrane-bound sacs found in chloroplasts, where the molecules of chlorophyll are located. Thylakoids are responsible for carrying out the light-dependent reactions of photosynthesis, where chlorophyll absorbs light energy and converts it into chemical energy. This explanation aligns with the information provided in the question and accurately describes the relationship between chlorophyll and thylakoids.

Submit

40. During the process of photosynthesis,  solar energy is converted into

Explanation

During the process of photosynthesis, solar energy is absorbed by plants and converted into chemical energy. This energy is then stored in the form of glucose molecules, which can be used by the plant for growth, reproduction, and other metabolic processes. This conversion of solar energy into chemical energy is essential for the survival of plants and is the basis of the food chain, as other organisms rely on plants for energy. Heat, thermal, mechanical, and nuclear energy are not directly involved in the process of photosynthesis.

Submit

41. What structural feature of a leaf allows a leaf to obtain CO2 from the air?

Explanation

The stoma is the correct answer because it is the small opening found on the surface of the leaf that allows for gas exchange. It is through the stoma that the leaf is able to obtain carbon dioxide (CO2) from the air, which is necessary for photosynthesis to occur. The epidermis is the outermost layer of the leaf, the cuticle is the waxy layer that covers the leaf, the mesophyll is the tissue inside the leaf where photosynthesis takes place, and the chloroplasts are the organelles within the mesophyll cells where photosynthesis occurs. However, none of these structures directly allow for the leaf to obtain CO2 from the air.

Submit

42. In the lactose lab exercise, the addition of the heated lactase enzyme to the milk did not change the pH because

Explanation

The addition of the heated lactase enzyme to the milk did not change the pH because the denatured lactase was biologically inactive.

Submit

43. You have the following mRNA molecule.  Given that the AUG is the start codon and the UGA Is the stop condon, indicate the number of aminoacids systhesized from this RNA molecle. 5’ AGGAUGCCCGGGCCCUGAUUG3’

Explanation

The given mRNA molecule starts with the start codon AUG and ends with the stop codon UGA. The codons in between are UCC, CGG, GCC, GGG, CCC, UGA, and UUG. Each codon codes for one amino acid. Therefore, there are 4 amino acids synthesized from this RNA molecule.

Submit

44. The sequence of nitrogen-containing bases on one strand of DNA most directly determines the sequence of

Explanation

The sequence of nitrogen-containing bases on one strand of DNA determines the sequence of amino acids in a protein molecule. This is because the DNA sequence is transcribed into mRNA, which is then translated into a sequence of amino acids during protein synthesis. The sequence of amino acids determines the structure and function of the protein.

Submit

45. Which of the following molecules functions to transfer genetic information from the nucleus to the cytoplasm?

Explanation

mRNA, or messenger RNA, functions to transfer genetic information from the nucleus to the cytoplasm. After transcription, mRNA carries the genetic code from DNA to the ribosomes in the cytoplasm, where it is used as a template for protein synthesis. This process is known as translation. mRNA acts as an intermediary molecule, carrying the instructions for protein synthesis from the nucleus, where the DNA is located, to the site of protein synthesis in the cytoplasm. Therefore, mRNA is responsible for transferring genetic information from the nucleus to the cytoplasm.

Submit

46. An anticodon is

Explanation

An anticodon is a sequence of three nucleotides found on transfer RNA (tRNA) molecules. It is complementary to a specific codon on messenger RNA (mRNA) during protein synthesis. The anticodon ensures that the correct amino acid is brought to the ribosome during translation. Therefore, the correct answer is "3 consecutive nucleotides in tRNA".

Submit

47. In exergonic chemical reactions

Explanation

In exergonic chemical reactions, the reactants have more energy than the products. This means that the reactants are in a higher energy state compared to the products. During the reaction, energy is released, and the reactants undergo a decrease in energy to form the products. This is why exergonic reactions are often described as spontaneous or releasing energy.

Submit

48. Light-dependent photosynthetic reactions produce

Explanation

Light-dependent photosynthetic reactions occur in the thylakoid membrane of chloroplasts and involve the absorption of light energy by chlorophyll. This energy is used to produce ATP (adenosine triphosphate) and NADPH (nicotinamide adenine dinucleotide phosphate), which are energy-rich molecules. Additionally, these reactions also release oxygen (O2) as a byproduct. Therefore, the correct answer is ATP, NADPH, O2.

Submit

49. Which of the following is an example of an electron carrier molecule?

Explanation

NAD (nicotinamide adenine dinucleotide) is an example of an electron carrier molecule. It plays a crucial role in cellular respiration by accepting and donating electrons during the process of energy production. NAD acts as a coenzyme, facilitating the transfer of electrons from one molecule to another, thus participating in various metabolic reactions.

Submit

50. All the following statements pertaining to catalysts are true EXCEPT

Explanation

Enzymes are biological catalysts that have specific activity, meaning they are highly specialized in catalyzing specific reactions. This specificity allows enzymes to bind to specific substrates and convert them into products. Therefore, the statement that enzymes are biological catalysts lacking specific activity is incorrect.

Submit
×
Saved
Thank you for your feedback!
View My Results
Cancel
  • All
    All (50)
  • Unanswered
    Unanswered ()
  • Answered
    Answered ()
The function of the promoter is to signal the ...
Allosterc sites of enzymes are the same as the ...
In the lactase lab, the lactose was present in the milk
The start codon can be the code for any of the 20 amino acids
Pick the best choice for the following statement ...
In the chromatography lab, you separated the ...
An _________ chemical reaction releases energy ...
What results if glucose is metabolized under ...
Which of the following is part of the first law of thermodynamics
What kind of mutation occurs when one base is ...
In the lab, when observing the mesophyll cells ...
If the sequence of bases in a section of DNA is ...
The process of copying genetic information from DNA to RNA is called
The majority of the leaf’s chloroplasts are ...
Enzyme activity is influenced by
Which of the following has the greatest amount of kinetic energy?
What is the ultimate source of energy for most ...
The most ATP is produces during which of the following processes
The most common energy carrier molecule of living organisms is
Semiconservative DNA replication means
Which of these is found in RNA but NOT in DNA?
During glycolysis, what is the net gain of ATP molecules produced?
Which of the following has potential energy?
Complementary base pairs are held together by
The strand of the DNA molecule that is used to ...
Entropy is a measure of
What factors influence the rate of photsynthesis?
The sequence of subunits in the DNA “backbone” is
When DNA polymerase is in contact with thymine ...
Chemiosmosis in mitochondria directly results in the synthesis of
Imagine you are conducting an experiment on a ...
When a cell divides
Both plants and animals perform
The number of consecutive mRNA bases needed to ...
The reactant in an enzyme-catalyzed reaction is the
Erythrpoietin (EPO) stimulates which of the following processes
Which of the following processes occur(s) in the cytoplasm?
If a bacterial protein has 30 amino acids, how ...
 Specifically, molecules of chlorophyll are ...
During the process of photosynthesis,  solar energy is converted...
What structural feature of a leaf allows a leaf ...
In the lactose lab exercise, the addition of the ...
You have the following mRNA molecule.  Given that the AUG is the...
The sequence of nitrogen-containing bases on one ...
Which of the following molecules functions to ...
An anticodon is
In exergonic chemical reactions
Light-dependent photosynthetic reactions produce
Which of the following is an example of an electron carrier molecule?
All the following statements pertaining to catalysts are true EXCEPT
play-Mute sad happy unanswered_answer up-hover down-hover success oval cancel Check box square blue
Alert!