Genetics Final Exam

Reviewed by Editorial Team
The ProProfs editorial team is comprised of experienced subject matter experts. They've collectively created over 10,000 quizzes and lessons, serving over 100 million users. Our team includes in-house content moderators and subject matter experts, as well as a global network of rigorously trained contributors. All adhere to our comprehensive editorial guidelines, ensuring the delivery of high-quality content.
Learn about Our Editorial Process
| By ProfGentle
P
ProfGentle
Community Contributor
Quizzes Created: 1 | Total Attempts: 4,919
| Attempts: 4,981 | Questions: 100 | Updated: Jul 9, 2025
Please wait...
Question 1 / 100
0 %
0/100
Score 0/100
1. G and U are present in both DNA and RNA

Explanation

G and U are not present in both DNA and RNA. DNA contains the base Guanine (G), while RNA contains the base Uracil (U). Therefore, the statement is false.

Submit
Please wait...
About This Quiz
Genetics Final Exam - Quiz

You might wonder why it’s so important to analyze the small, seemingly insignificant details of a person’s genetic make-up. But what you might not realize is that some things about ourselves can’t be seen by the naked eye – like a person’s chances of developing a terminal illness as a... see moreresult of it being passed down from parent to offspring. What can you tell us about genetics? see less

2.
You may optionally provide this to label your report, leaderboard, or certificate.
2. The basic structure of nucleotide includes the following components

Explanation

The correct answer is base, sugar, phosphate. Nucleotides are the building blocks of DNA and RNA, and they consist of three main components: a nitrogenous base (adenine, guanine, cytosine, or thymine/uracil), a sugar molecule (deoxyribose in DNA or ribose in RNA), and a phosphate group. These components combine to form a nucleotide, which then join together to form the DNA and RNA strands. The base pairs in DNA (adenine with thymine and guanine with cytosine) and the sequence of nucleotides in RNA determine the genetic information encoded in these molecules.

Submit
3. Introns are removed from precursor mRNAs by spliceosomes

Explanation

The statement is true because spliceosomes are responsible for removing introns from precursor mRNA molecules. Spliceosomes are large complexes made up of proteins and small nuclear RNA molecules. They recognize specific sequences at the beginning and end of introns, and then catalyze the removal of the introns through a process called splicing. This results in the production of mature mRNA molecules that only contain the exons, which are the coding regions of the gene. Therefore, the correct answer is true.

Submit
4. Frameshift mutations generally have more drastic effects on the phenotype than do substitutions.

Explanation

Frameshift mutations occur when nucleotides are inserted or deleted in the DNA sequence, causing a shift in the reading frame. This shift alters the codons, which changes the amino acid sequence during translation. As a result, the protein produced is usually nonfunctional or severely impaired. On the other hand, substitutions only replace one nucleotide with another, which may or may not change the amino acid sequence. Therefore, frameshift mutations have more drastic effects on the phenotype as they can completely disrupt the protein's structure and function.

Submit
5. ________ results when chromatids fail to separate and move to opposite poles during anaphase. 

Explanation

Nondisjunction is the correct answer because it refers to the failure of chromatids to separate and move to opposite poles during anaphase. This can result in an abnormal distribution of chromosomes in the daughter cells, leading to genetic disorders or abnormalities. Transposition, translocation, duplication, and segregation do not specifically refer to the failure of chromatids to separate during anaphase.

Submit
6. Typically, a small subset of genes are expressed in each type of cell within an organism.

Explanation

Each type of cell within an organism has a specific function and therefore requires specific genes to be expressed. This ensures that the cell can carry out its specialized role effectively. If all genes were expressed in every cell, there would be a lack of specificity and coordination in the organism's functions. Therefore, it is true that only a small subset of genes are expressed in each type of cell within an organism.

Submit
7. The appearance of traits expressed by genes in association with environmental influence is referred to as the organism's 

Explanation

The appearance of traits expressed by genes in association with environmental influence is referred to as the organism's phenotype. The phenotype is the observable characteristics of an organism, such as its physical appearance, behavior, and other traits. It is determined by the interaction between an organism's genotype (its genetic makeup) and its environment. The phenotype can be influenced by various factors, including genetic mutations, gene expression, and environmental factors such as diet, temperature, and exposure to toxins.

Submit
8.                 opens the double helix for replication machinery.

Explanation

Helicase is responsible for opening the double helix structure of DNA during replication. It does this by breaking the hydrogen bonds between the DNA strands, allowing the replication machinery to access the DNA template strands and synthesize new complementary strands. Helicase acts as a molecular motor, using energy from ATP hydrolysis to unwind the DNA helix and separate the strands. This process is crucial for DNA replication, as it provides the single-stranded DNA templates needed for DNA polymerases to synthesize new DNA strands.

Submit
9. For any gene with multiple alleles, a diploid organism may have a maximum of ________ alleles for that locus.

Explanation

For any gene with multiple alleles, a diploid organism may have a maximum of 2 alleles for that locus. This is because diploid organisms have two sets of chromosomes, one inherited from each parent. Each set of chromosomes carries one allele for each gene. Therefore, a diploid organism can have a maximum of two different alleles for any given gene locus.

Submit
10. Proto-oncogenes are found in normal, non-cancerous cells and are responsible for normal cell processes.

Explanation

Proto-oncogenes are indeed found in normal, non-cancerous cells. These genes play a crucial role in regulating normal cell processes, such as cell growth, division, and differentiation. However, under certain circumstances, proto-oncogenes can become oncogenes, which are genes that have the potential to cause cancer. This transformation can occur due to genetic mutations or alterations in the regulation of proto-oncogenes. Therefore, the statement that proto-oncogenes are found in normal, non-cancerous cells and are responsible for normal cell processes is true.

Submit
11. The primary structure of a protein is determined by

Explanation

The primary structure of a protein refers to the specific sequence of amino acids that make up the protein chain. This sequence is determined by the genetic code and is crucial for the overall structure and function of the protein. The sequence of amino acids determines how the protein folds into its three-dimensional shape and how it interacts with other molecules in the body. Therefore, the correct answer is that the primary structure of a protein is determined by the sequence of amino acids.

Submit
12. In lilies, white flowers (W) are dominant to purple flowers (w).  If two plants that are heterozygous for flower color are mated, the offspring might have which genotype? 

Explanation

If two plants that are heterozygous for flower color (Ww) are mated, the possible genotypes of the offspring are WW, Ww, and ww. This is because the dominant allele (W) can be inherited from one parent, resulting in the genotype WW, while the recessive allele (w) can be inherited from the other parent, resulting in the genotype ww. Additionally, there is a 50% chance that the offspring will inherit the dominant allele (W) from one parent and the recessive allele (w) from the other parent, resulting in the genotype Ww. Therefore, all of the above genotypes are possible outcomes of the mating.

Submit
13. All RNAs are translated.

Explanation

Not all RNAs are translated. While messenger RNA (mRNA) is translated into proteins, other types of RNA such as transfer RNA (tRNA) and ribosomal RNA (rRNA) are involved in the process of translation but are not themselves translated. Additionally, non-coding RNAs do not undergo translation. Therefore, the statement that all RNAs are translated is false.

Submit
14. A Barr body is an

Explanation

A Barr body is a condensed, inactive X chromosome that is typically found in the nuclei of female cells. In females, one of the two X chromosomes is randomly inactivated during early development to ensure dosage compensation between males and females. This inactivated X chromosome becomes highly compacted and forms a dense structure known as a Barr body. The presence of a Barr body can be used to identify the sex of an individual's cells, as males typically have one X chromosome and females have two, with one being inactivated.

Submit
15. What is the name for the statistical measure used to describe sample variability

Explanation

Variance is the statistical measure used to describe sample variability. It quantifies how spread out the data points in a sample are from the mean. A higher variance indicates that the data points are more scattered, while a lower variance suggests that the data points are closer to the mean. Variance is calculated by taking the average of the squared differences between each data point and the mean.

Submit
16. A purine’s being replaced by a different purine is called a transition mutation.

Explanation

A purine's being replaced by a different purine is called a transition mutation. This means that if a purine base (adenine or guanine) is replaced by another purine base, it is considered a transition mutation. This is true because transition mutations involve the substitution of a nucleotide with a different nucleotide of the same type (purine to purine or pyrimidine to pyrimidine).

Submit
17. Regulation of the lac operon of E. coli by lactose is both negative and inducible

Explanation

The regulation of the lac operon of E. coli by lactose is both negative and inducible. This means that the presence of lactose acts as an inducer, causing the lac operon to be transcribed and translated into enzymes that can break down lactose. However, the regulation is also negative, meaning that in the absence of lactose or the presence of glucose, the lac operon is repressed and not transcribed. Therefore, the statement "Regulation of the lac operon of E. coli by lactose is both negative and inducible" is true.

Submit
18. Given an inheritance pattern of incomplete dominance and 81 flowers are red (R1R1), 18 flowers are pink (R1R2), and 1 flower is white (R2R2), the frequency of the R1 allele is 0.9.

Explanation

The given information states that there are 81 red flowers (R1R1), 18 pink flowers (R1R2), and 1 white flower (R2R2) in the population. In incomplete dominance, the heterozygous genotype (R1R2) displays a phenotype that is intermediate between the two homozygous genotypes (R1R1 and R2R2). Since the frequency of the R1 allele is stated to be 0.9, it means that the R1 allele is present in a majority of the population. Therefore, the statement "True" is the correct answer.

Submit
19. An organism's complete set of genes is called its 

Explanation

The correct answer is genotype. Genotype refers to the complete set of genes that an organism possesses. It includes all the genetic information encoded in an organism's DNA. This term is used to describe the genetic makeup of an individual, which determines the traits and characteristics that they may exhibit.

Submit
20. At the conclusion of meiosis, there are ________ cells

Explanation

At the conclusion of meiosis, there are four haploid cells. Meiosis is a type of cell division that occurs in sexually reproducing organisms to produce gametes (sperm and egg cells). During meiosis, a single diploid cell undergoes two rounds of division, resulting in the formation of four haploid cells. Haploid cells contain half the number of chromosomes as the original diploid cell, allowing for genetic diversity in offspring during sexual reproduction. Therefore, the correct answer is four haploid cells.

Submit
21. A(n)                  gene masks the expression of a different, nonallelic gene.

Explanation

Epistasis refers to the interaction between two or more genes where the expression of one gene masks or modifies the expression of another gene. In this case, the gene in question is masking the expression of a different, nonallelic gene, indicating an epistatic relationship. This means that the gene is exerting control over the expression of the other gene, overriding its normal function or expression pattern. Therefore, the correct answer is epistatic.

Submit
22. DNA-dependent DNA polymerase

Explanation

DNA Polymerase I is the correct answer because it is an enzyme that is involved in DNA replication and repair. It is responsible for removing the RNA primers during DNA replication and replacing them with DNA nucleotides. DNA Polymerase I also has a 5' to 3' exonuclease activity, which allows it to proofread and correct errors in the newly synthesized DNA strand. Additionally, DNA Polymerase I has a role in DNA recombination and the repair of damaged DNA.

Submit
23. Nonsense mutations do not alter DNA sequence information.

Explanation

Nonsense mutations actually do alter DNA sequence information. These mutations introduce premature stop codons in the coding region of a gene, causing the synthesis of a truncated and usually nonfunctional protein. This alteration in the DNA sequence disrupts the normal functioning of the gene and can lead to various genetic disorders or diseases. Therefore, the correct answer is False.

Submit
24. The genetic material of eukaryotic cells is duplicated during which stage of cell cycle?

Explanation

During the S phase of the cell cycle, the genetic material of eukaryotic cells is duplicated. This phase is also known as the synthesis phase, where DNA replication occurs. The cell prepares itself for division by creating an identical copy of its DNA. This ensures that each daughter cell will have a complete set of genetic material. The S phase is followed by the G2 phase, where the cell prepares for cell division, and then the M phase, where the actual cell division takes place. Therefore, the correct answer is S.

Submit
25. Chromatin contains

Explanation

Chromatin is a complex structure found in the nucleus of cells that contains DNA and proteins. DNA is the genetic material that carries the instructions for the development and functioning of all living organisms. Proteins, on the other hand, play various roles in the organization and regulation of DNA. Therefore, the correct answer is D) both A and C, as chromatin contains both DNA and protein.

Submit
26. The mating system in E.coli is known as?

Explanation

Conjugation is the correct answer because it refers to the process by which E. coli transfers genetic material to another bacterium through direct cell-to-cell contact. This process allows for the exchange of plasmids, which are small, circular pieces of DNA that can carry beneficial genes such as antibiotic resistance. Conjugation plays a crucial role in bacterial evolution and the spread of antibiotic resistance genes among bacterial populations.

Submit
27. Most genes in prokaryotes and eukaryotes are regulated primarily at which level of expression?

Explanation

Genes in both prokaryotes and eukaryotes are primarily regulated at the level of transcription. This is because transcription is the process by which the genetic information in DNA is used to synthesize RNA molecules, which then serve as templates for protein synthesis. By controlling the rate of transcription, cells can regulate the amount of RNA produced and therefore the amount of protein that is ultimately synthesized. This allows cells to respond to changing environmental conditions and to regulate gene expression in a precise and coordinated manner.

Submit
28. A eukaryotic promoter contains a Pribnow box

Explanation

A eukaryotic promoter does not contain a Pribnow box. The Pribnow box, also known as the -10 element, is a conserved DNA sequence found in prokaryotic promoters. It is recognized by RNA polymerase and plays a crucial role in initiating transcription. In eukaryotes, transcription is initiated by different promoter elements, such as the TATA box and the initiator element (Inr), which are distinct from the Pribnow box. Therefore, the statement that a eukaryotic promoter contains a Pribnow box is false.

Submit
29. If the percentage of uracil in a double-stranded RNA molecule is 30%, the percentage of cytosine is?

Explanation

In a double-stranded RNA molecule, the percentage of uracil and cytosine should be equal since they pair together. If the percentage of uracil is 30%, then the percentage of cytosine should also be 30%. Therefore, the answer of 20% is incorrect.

Submit
30. In a double-stranded RNA molecule of 10,000 base pairs, the approximate number of complete turns is?

Explanation

In a double-stranded RNA molecule, the two strands are twisted around each other in a helical structure. The number of complete turns refers to the number of times the two strands wrap around each other in a full circle. In this case, the approximate number of complete turns in a 10,000 base pair RNA molecule is 1000. This means that the two strands wrap around each other 1000 times to form the helical structure.

Submit
31. Plasmids that can confer the ability to conjugate are known as?

Explanation

F plasmids are known as plasmids that can confer the ability to conjugate. Conjugation is a mechanism of horizontal gene transfer in bacteria where genetic material is transferred between two bacterial cells through direct cell-to-cell contact. F plasmids contain the Fertility (F) factor which allows them to transfer their genetic material to recipient cells during conjugation. This transfer can lead to the acquisition of new traits or resistance to antibiotics. Therefore, F plasmids are specifically associated with the ability to conjugate.

Submit
32. The ratio of (A+G) to (T+C) in a double-stranded DNA molecule is equal to 1

Explanation

The ratio of (A+G) to (T+C) in a double-stranded DNA molecule is equal to 1, meaning that the number of adenine (A) and guanine (G) bases is equal to the number of thymine (T) and cytosine (C) bases. This is because in DNA, adenine always pairs with thymine and guanine always pairs with cytosine, forming base pairs. Therefore, if the ratio is equal to 1, it indicates that the DNA molecule is properly paired and balanced.

Submit
33. DNA synthesis in eukaryotes is?

Explanation

DNA synthesis in eukaryotes is semi-conservative. This means that during replication, each strand of the original DNA molecule serves as a template for the synthesis of a new complementary strand. As a result, each new DNA molecule formed contains one original strand and one newly synthesized strand. The other options, proceeding in a 3' to 5' direction and involving a single protein, are not accurate statements about DNA synthesis in eukaryotes.

Submit
34. That some organisms contain much larger amounts of DNA than apparently "needed" and that some relatively closely related organisms may have vastly different amounts of DNA is more typical in

Explanation

Eukaryotes, which include plants, animals, fungi, and protists, generally have larger amounts of DNA compared to prokaryotes, which are bacteria and archaea. This is because eukaryotes have more complex cellular structures and functions that require a larger amount of genetic information. Prokaryotes, on the other hand, have simpler cellular structures and therefore do not require as much DNA. This difference in DNA content is more typical in eukaryotes than in prokaryotes.

Submit
35. Chromosomal inversions result in duplications and deletions

Explanation

Chromosomal inversions can indeed result in duplications and deletions. During a chromosomal inversion, a segment of the chromosome is flipped in orientation. This can lead to the breakage and rearrangement of genetic material, causing duplications and deletions of certain genes or regions. Therefore, the statement is true.

Submit
36. Crossing over occurs most frequently during which stage of cell division? 

Explanation

Crossing over occurs most frequently during prophase I of meiosis. This is because during prophase I, homologous chromosomes pair up and exchange genetic material through a process called crossing over. This exchange of genetic material increases genetic diversity and helps in the formation of genetically unique gametes. In contrast, crossing over does not occur during metaphase II, prophase and telophase of mitosis, or prophase II of meiosis.

Submit
37. Enzyme that charges tRNAs

Explanation

Aminoacyl transferase is the enzyme responsible for charging tRNAs. Charging refers to the process of attaching the correct amino acid to the corresponding tRNA molecule, which is necessary for protein synthesis. DNA Polymerase I is involved in DNA replication, not tRNA charging. RNA Polymerase II and RNA Polymerase III are responsible for transcribing DNA into RNA, but they are not involved in charging tRNAs. Therefore, the correct answer is Aminoacyl transferase.

Submit
38. For a species with a diploid number of 18 chromosomes, how many chromosomes will be present in the somatic nuclei of individuals that are tetraploid?

Explanation

A diploid number (2n) of 18 means the normal somatic cells have 18 chromosomes. Tetraploid organisms have four sets of chromosomes (4n), so their somatic cells contain twice the diploid number:

4 × 9 = 36 chromosomes.

Submit
39. Proto-oncogenes cause cancer.

Explanation

Proto-oncogenes do not directly cause cancer. They are normal genes that play a role in regulating cell growth and division. However, when proto-oncogenes undergo certain changes or mutations, they can become oncogenes, which have the potential to cause cancer. Therefore, it is incorrect to say that proto-oncogenes cause cancer.

Submit
40. Bacterial Recombination requires?

Explanation

Bacterial recombination requires all of the above options because F pilus is necessary for the transfer of genetic material between bacteria, plasmids are the carriers of the genetic material being transferred, and physical contact between bacteria is required for the transfer to occur. Therefore, all three options are essential for bacterial recombination to take place.

Submit
41.                 relieves torsional stress.

Explanation

Gyrase is the correct answer because it is an enzyme that relieves torsional stress during DNA replication. Torsional stress occurs when the DNA double helix becomes overwound or underwound during the unwinding process. Gyrase helps to alleviate this stress by introducing negative supercoils into the DNA, allowing for smooth unwinding and replication to occur. This ensures that the DNA strands do not become tangled or damaged during the replication process.

Submit
42. An individual heterozygous for d e f was crossed to a homozygous recessive individual (d/d e/e f/f).  The following offspring were recovered. +  +  +             39 +  e  f               372 d  +  f               7 d  e  f               47 +  e  +              5 d  +  +              412  What is the correct order of these genes?

Explanation

The correct order of these genes is def because in the offspring, the genotype + + + is the most frequent, followed by + e f, d + f, d e f, + e +, and d + +. This indicates that the dominant allele for each gene (represented by +) is present in the majority of the offspring, suggesting that it is the first gene in the order. The second gene can be determined by looking at the offspring with the genotype + e f, which is the second most frequent genotype. This indicates that the heterozygous individual must have the e allele, and the homozygous recessive individual must have the f allele. Therefore, the correct order is def.

Submit
43. Which of the following is a nonhistone protein found in chromatin? 

Explanation

HMG (High Mobility Group) is a nonhistone protein found in chromatin. It functions as a structural protein that helps in the organization and stabilization of chromatin structure. HMG proteins are involved in various cellular processes such as transcription, DNA repair, and recombination. They bind to DNA and help in regulating gene expression by facilitating the binding of transcription factors and other proteins to DNA. Unlike histone proteins, which are also found in chromatin, HMG proteins do not participate in nucleosome formation but play a crucial role in maintaining chromatin architecture.

Submit
44. The transfer of bacterial genes from one cell to another requires?

Explanation

The transfer of bacterial genes from one cell to another requires multiple factors, including the F factor, F plasmids, and F+ cells. The F factor is a piece of DNA that allows for the transfer of genetic material between bacterial cells. F plasmids are self-replicating circular pieces of DNA that contain the F factor and are responsible for transferring the F factor to other cells. F+ cells are bacterial cells that contain the F factor and are capable of transferring genetic material to F- cells. Therefore, all of these factors are necessary for the transfer of bacterial genes.

Submit
45. In the absence of allolactose, the lac operon is constitutively transcribed.

Explanation

The lac operon is a group of genes involved in lactose metabolism in bacteria. In the absence of allolactose, which is an inducer molecule, the lac operon is not transcribed constitutively. Instead, it is repressed by a regulatory protein called the lac repressor. The lac repressor binds to the operator region of the lac operon, preventing RNA polymerase from transcribing the genes. When allolactose is present, it binds to the lac repressor and causes a conformational change, releasing the repressor from the operator and allowing transcription of the lac operon. Therefore, the statement that the lac operon is constitutively transcribed in the absence of allolactose is false.

Submit
46. In human males, genes on the X chromosome are

Explanation

In human males, genes on the X chromosome are hemizygous. This is because males have one X chromosome and one Y chromosome, while females have two X chromosomes. Therefore, males have only one copy of genes on the X chromosome, making them hemizygous.

Submit
47. In the absence of glucose, the CAP protein binds to a DNA sequence adjacent to the promoter of the lac operon.  Binding of CAP helps RNA polymerase to bind to the promoter and allows for a high level of transcription of the lac operon.  Regulation of the lac operon by the CAP protein is an example of

Explanation

The binding of the CAP protein to the DNA sequence adjacent to the promoter of the lac operon in the absence of glucose helps RNA polymerase to bind to the promoter, resulting in a high level of transcription of the lac operon. This indicates that the CAP protein positively regulates the lac operon by enhancing the transcription process.

Submit
48. Which of the following groups of proteins is NOT commonly known to include oncogenes?

Explanation

Ion channels are NOT commonly known to include oncogenes. Oncogenes are genes that have the potential to cause cancer when mutated or overexpressed. They are typically involved in cell growth, division, and regulation. Transcription factors, growth factors, signal-transduction proteins, and DNA-repair enzymes are all commonly associated with oncogenes as they play crucial roles in cellular processes that can become dysregulated in cancer. However, ion channels primarily regulate the flow of ions across cell membranes and are not typically implicated in oncogenesis.

Submit
49. If the sequence of an RNA molecule is 5’-GGCAUCGACG-3’, what is the sequence of the template strand of DNA?

Explanation

The sequence of the template strand of DNA is the complementary sequence to the RNA molecule. In RNA, adenine (A) pairs with uracil (U), cytosine (C) pairs with guanine (G), and vice versa in DNA. Therefore, the template strand of DNA would have the sequence 3’-CCGTAGCTGC-5’, which is the complementary sequence to the given RNA sequence.

Submit
50. Which of the following is not different between eukaryotic and prokaryotic transcription?

Explanation

The correct answer is "all are different". This means that all of the options listed (splicing, 5' capping, poly-adenylation, and termination) are different between eukaryotic and prokaryotic transcription. In eukaryotes, splicing is required to remove introns from the pre-mRNA, 5' capping is the addition of a modified guanine nucleotide to the 5' end of the mRNA, poly-adenylation is the addition of a poly-A tail to the 3' end of the mRNA, and termination involves the recognition of specific termination sequences. In contrast, prokaryotic transcription does not involve splicing, 5' capping, or poly-adenylation, and termination occurs differently.

Submit
51. When one speaks of a 5' cap, one is usually describing?

Explanation

The correct answer is addition of a guanine to the 5’ end of an mRNA. The 5' cap is a modified guanine nucleotide that is added to the 5' end of the mRNA molecule during RNA processing. This modification helps protect the mRNA from degradation and is involved in various cellular processes such as mRNA export, translation initiation, and mRNA stability.

Submit
52. Which of the following statements about an animal bearing a somatic mutation is true?

Explanation

If an animal bears a somatic mutation, it means that the mutation has occurred in the cells of its body, but not in its reproductive cells. Therefore, the mutation will not be passed on to its offspring. However, the animal itself can be affected by the mutation, as it will be present in its somatic cells. This means that the animal's offspring will not carry the mutation, and only the animal itself will show the mutant trait.

Submit
53.    ??       speciation is initiated by a geographic barrier to gene flow

Explanation

Allopatric speciation is a type of speciation that occurs when a geographic barrier prevents gene flow between two populations of a species. The barrier could be a physical barrier like a mountain range or a body of water, or it could be a result of migration to a new habitat. The isolation of the populations leads to independent evolutionary changes, eventually resulting in the formation of two distinct species. This process is different from sympatric speciation, where new species arise in the same geographic area without a physical barrier.

Submit
54. A man with blood type A and a woman with blood type B could never produce a child with blood type

Explanation

When a man with blood type A and a woman with blood type B have a child, there is a possibility that the child could inherit either blood type A or B from their parents. This is because blood type A is determined by having either two A alleles or one A and one O allele, while blood type B is determined by having either two B alleles or one B and one O allele. Therefore, it is possible for the child to have blood type A, B, or AB, making "none of the above" the correct answer.

Submit
55. The phenomenon of crossovers in nearby regions is called

Explanation

Chiasma is the correct answer because it refers to the phenomenon of crossovers in nearby regions during the process of genetic recombination. During meiosis, homologous chromosomes exchange genetic material at specific points called chiasmata, resulting in the formation of recombinant chromosomes. This process leads to genetic diversity and plays a crucial role in evolution.

Submit
56. The codon for methionine appears only at the beginning of the mRNA for a protein, not in the middle or in the end.

Explanation

The codon for methionine, AUG, can appear not only at the beginning of the mRNA for a protein but also in the middle or at the end. This codon serves as the start codon, initiating protein synthesis, but it can also be found within the coding sequence of a protein as a regular amino acid codon. Therefore, the statement that the codon for methionine appears only at the beginning of the mRNA for a protein is incorrect.

Submit
57. The two major components of Tobacco Mosaic Virus are?

Explanation

Tobacco Mosaic Virus is composed of RNA and protein. RNA is the genetic material of the virus, which carries the instructions for viral replication and protein synthesis. The protein component of the virus plays a crucial role in protecting the RNA and facilitating its entry into host cells. Together, RNA and protein make up the major components of Tobacco Mosaic Virus.

Submit
58. Hershey and Chase differentiated between DNA and protein by:

Explanation

Hershey and Chase differentiated between DNA and protein by labeling the DNA with 32Phosphorous and the proteins with 35Sulfur. This method allowed them to track the movement of these labeled molecules during the infection process. Since DNA contains phosphorous but not sulfur, and proteins contain sulfur but not phosphorous, they were able to determine that the genetic material of bacteriophages (viruses that infect bacteria) is DNA, not protein.

Submit
59. Homologous genes in the same organism are called?

Explanation

Homologous genes in the same organism are called paralogs. Paralogs are genes that have evolved from a common ancestral gene through gene duplication events. They have similar sequences and functions but may have diverged over time to perform slightly different roles within the same organism. This is in contrast to orthologs, which are homologous genes found in different species that have evolved from a common ancestral gene through speciation events. The options "Related" and "Duplications" are not accurate terms to describe homologous genes in the same organism.

Submit
60. A person who is known to have a particular genotype does not show the phenotype specified by the gene. This is an example of 

Explanation

Incomplete penetrance refers to a situation where individuals with the same genotype do not always express the associated phenotype. In this case, the person known to have a particular genotype does not exhibit the phenotype specified by the gene. This suggests that there are other factors or modifiers that influence the expression of the gene, leading to incomplete penetrance.

Submit
61.                 removes RNA primer.

Explanation

DNA Pol I is responsible for removing RNA primers during DNA replication. RNA primers are short sequences of RNA that are synthesized by the enzyme Primase and serve as a starting point for DNA synthesis. Once DNA synthesis is complete, DNA Pol I replaces the RNA primers with DNA nucleotides, effectively removing them from the newly synthesized DNA strand. This process is essential for the completion of DNA replication and the production of a continuous DNA strand. Telomerase is involved in the replication of telomeres, Helicase unwinds the DNA double helix, Primase synthesizes RNA primers, and Gyrase relieves the tension caused by the unwinding of the DNA.

Submit
62. Enzyme involved in transcription of mRNA

Explanation

RNA Polymerase II is the correct answer because it is the enzyme responsible for transcribing DNA into mRNA during the process of transcription. RNA Polymerase II recognizes specific DNA sequences called promoters and binds to them, initiating the synthesis of mRNA from the DNA template. This enzyme plays a crucial role in gene expression by transcribing the genetic information stored in DNA into a functional mRNA molecule, which can then be translated into proteins. DNA Polymerase I, Aminoacyl transferase, and RNA Polymerase III are not directly involved in the transcription of mRNA.

Submit
63. For most protein-encoding genes, the synonymous rate of change is:

Explanation

The synonymous rate of change refers to the rate at which silent mutations occur in the DNA sequence of a protein-encoding gene, meaning the change does not result in a change in the amino acid sequence of the protein. The nonsynonymous rate of change, on the other hand, refers to the rate at which mutations occur that do result in a change in the amino acid sequence of the protein. The given answer suggests that the synonymous rate of change is considerably higher than the nonsynonymous rate, indicating that silent mutations occur more frequently than mutations that result in a change in the protein sequence.

Submit
64. Messenger RNA is usually polycistronic in eukaryotes

Explanation

Messenger RNA (mRNA) in eukaryotes is typically monocistronic, meaning it carries the genetic information for a single gene. This is in contrast to prokaryotes, where mRNA is often polycistronic and can carry the information for multiple genes. In eukaryotes, each gene is transcribed into a separate mRNA molecule, allowing for more precise regulation of gene expression. Therefore, the statement that messenger RNA is usually polycistronic in eukaryotes is false.

Submit
65. In catabolite repression of the lac operon, glucose affects most directly the

Explanation

Glucose directly affects the level of cAMP in catabolite repression of the lac operon. When glucose is present, it inhibits the production of cAMP by inhibiting the enzyme adenylate cyclase. This decrease in cAMP levels prevents the catabolite-activating protein (CAP) from binding to the lac operon promoter, which in turn prevents the lac operon from being activated. Therefore, glucose indirectly affects the lac operon by regulating the level of cAMP.

Submit
66. In the absence of tryptophan, the genes of the trp operon are not expressed.

Explanation

In the absence of tryptophan, the genes of the trp operon are expressed. This is because the trp operon is a repressible operon, meaning that it is normally turned on and producing tryptophan. However, when tryptophan levels are high, it acts as a corepressor and binds to the repressor protein, causing it to bind to the operator region and block the expression of the genes. Therefore, in the absence of tryptophan, the genes of the trp operon will be expressed.

Submit
67. The sugar ribose differs from deoxyribose by an OH group at the 5' C position 

Explanation

The sugar ribose differs from deoxyribose by the absence of an OH group at the 2' C position.

Submit
68. The genetic code is said to be “degenerate” because 

Explanation

The genetic code is said to be "degenerate" because there are more codons than amino acids. This means that multiple codons can code for the same amino acid. For example, the amino acid leucine can be encoded by six different codons. This redundancy in the genetic code provides flexibility and robustness, as it allows for some variations or mutations in the DNA sequence without necessarily changing the resulting protein sequence.

Submit
69. Which of the following codon pairs specify amino acids

Explanation

The codon pairs AUG and GUG both specify the amino acid methionine. AUG is the start codon and is responsible for initiating protein synthesis, while GUG is an alternative codon that also codes for methionine. Therefore, both codon pairs can be used to specify the same amino acid.

Submit
70. Homologous genes found in different species that evolved from a common ancestor are called?

Explanation

Orthologs are homologous genes found in different species that evolved from a common ancestor. They have similar functions and can be used to study evolutionary relationships between species. Paralogs, on the other hand, are homologous genes that are found within the same species and have diverged in function. "Related" is a vague term that does not specifically refer to homologous genes. Duplications can lead to the formation of paralogs, but not all duplications result in paralogs. Therefore, the correct answer is Orthologs.

Submit
71. Which of the following must exist within a population before evolution can take place?

Explanation

Genetic variation must exist within a population before evolution can take place. This is because evolution is the process of change in the inherited characteristics of a population over successive generations. Genetic variation refers to the differences in the genetic makeup of individuals within a population. These variations provide the raw material for natural selection, genetic drift, and other mechanisms of evolution to act upon. Without genetic variation, there would be no basis for natural selection to occur and no potential for the population to evolve.

Submit
72. Proteins are composed of strings of nucleotides connected together by 5' - 3' phosphodiester bonds.

Explanation

Proteins are not composed of strings of nucleotides connected by phosphodiester bonds. Proteins are actually composed of strings of amino acids connected by peptide bonds. Nucleotides, on the other hand, are the building blocks of nucleic acids such as DNA and RNA.

Submit
73. Which of the following statements is true:

Explanation

The correct answer is B and C because evolution can occur in groups, such as populations or species, as well as in individuals. Additionally, evolution can be directly observed through various scientific studies and experiments.

Submit
74. A wingless fruit fly is isolated from a population after exposure of the parental generation to EMS.  Eventually the mutation is shown to have occurred within the coding sequence of a gene that changes a 5’-GGC-3’ codon (encoding glycine) to a 5’-AGC-3’ codon (encoding serine).  Which term would not correctly describe this mutation?

Explanation

This mutation is not a transversion because a transversion is a type of point mutation where a purine base is replaced by a pyrimidine base, or vice versa. In this case, the mutation involves a substitution of one purine base (G) with another purine base (A), which is not a transversion.

Submit
75. The ratio of (A+T) to (G+C) in a double-stranded DNA molecule is equal to 1

Explanation

The ratio of (A+T) to (G+C) in a double-stranded DNA molecule is not equal to 1. In DNA, adenine (A) pairs with thymine (T) and guanine (G) pairs with cytosine (C). The base pairing rules dictate that the amount of A should be equal to the amount of T, and the amount of G should be equal to the amount of C. Therefore, the ratio of (A+T) to (G+C) is always 1:1, not equal to 1.

Submit
76. The presence of a single mutated gene is sufficient for retinoblastoma cancer to develop

Explanation

Retinoblastoma cancer is caused by the mutation of both copies of the RB1 gene, not just a single mutated gene. This means that both copies of the gene need to be mutated in order for the cancer to develop. Therefore, the statement that the presence of a single mutated gene is sufficient for retinoblastoma cancer to develop is false.

Submit
77. Given the following sequence, how large (# amino acids) is the most likely eukaryotic polypeptide produced?                                       ACGAUGAGGAGGAUGGUCAAUGAUGCUGGCUGUUGAUAUUAACAU

Explanation

The most likely eukaryotic polypeptide produced can be determined by identifying the start codon (AUG) and counting the number of codons (groups of three nucleotides) until a stop codon is encountered. In this sequence, the start codon is ACGAUGAGGAGGAUGGUC, and the stop codon is UAA. Counting the codons between the start and stop codons gives a total of 7 codons. Since each codon represents an amino acid, the most likely eukaryotic polypeptide produced would have 7 amino acids.

Submit
78. The correct order of activity in replication is

Explanation

The correct order of activity in replication is helicase, SSB, primase, Pol III, Pol I, and ligase. Helicase is responsible for unwinding the DNA double helix, allowing the replication process to begin. Single-strand binding proteins (SSB) then bind to the single-stranded DNA to stabilize it and prevent re-annealing. Primase synthesizes RNA primers that are necessary for DNA polymerase III (Pol III) to initiate replication. Pol III is the main DNA polymerase responsible for synthesizing new DNA strands. Pol I then removes the RNA primers and replaces them with DNA. Finally, ligase joins the Okazaki fragments on the lagging strand and seals any remaining nicks in the DNA backbone.

Submit
79. Which event is not normally associated with development of cancer?

Explanation

Proto-oncogenes are normal genes that regulate cell growth and division. When these genes are mutated or activated, they become oncogenes, which promote uncontrolled cell growth and can lead to cancer. Inactivation of a proto-oncogene would therefore not be associated with the development of cancer, as it would prevent the gene from promoting abnormal cell growth.

Submit
80. ) If purple (P) is dominant to white (p) and axial (A) is dominant to terminal (a), and in a cross of white, axial to purple, axial the ratio of offspring is   6/16 white, axial;       2/16 white, terminal;       6/16 purple, axial;       2/16 purple, terminal,                                     What is the genotype of the parents?

Explanation

The given ratio of offspring suggests that the cross is between two heterozygous parents. The genotype of the parents can be determined by looking at the dominant traits in the offspring. Since there are both white and purple offspring, one parent must be heterozygous for the white trait (Pp). Since there are both axial and terminal offspring, one parent must be heterozygous for the axial trait (Aa). Therefore, the genotype of the parents is PpAa X ppAa.

Submit
81.     ??      speciation arises in the absence of any geographic barrier to gene flow:

Explanation

Sympatric speciation occurs when new species arise in the absence of any geographic barrier to gene flow. This means that the speciation process happens within the same geographic area, without any physical separation preventing gene exchange. In sympatric speciation, reproductive isolation is usually driven by factors such as ecological specialization, polyploidy, or sexual selection. This allows for the emergence of new species from a single population, without the need for physical isolation or geographic barriers.

Submit
82. An allopolyploid consists of more than 2 haploid sets of chromosomes, originating from the same species.

Explanation

An allopolyploid consists of more than 2 haploid sets of chromosomes, originating from different species.

Submit
83. Assume that a cross is made between tall and dwarf tobacco plants.  The F1 generation showed intermediate height, while the F2 generation showed a distribution of height ranging from tall to dwarf, like the original parents, and many heights between the extremes.  These data are consistent with the following mode of inheritance:

Explanation

The F1 generation showing intermediate height suggests that there are multiple factors or genes involved in determining the height of tobacco plants. The F2 generation showing a distribution of heights ranging from tall to dwarf, like the original parents, and many heights between the extremes further supports the idea of multiple-factor inheritance. This means that the height of the tobacco plants is influenced by the combination of different genes or factors, rather than being determined by a single gene.

Submit
84.                actually synthesizes RNA, not DNA. 

Explanation

Primase is the correct answer because it is an enzyme that is responsible for synthesizing RNA primers during DNA replication. These RNA primers are necessary for DNA polymerase to initiate the synthesis of new DNA strands. Primase synthesizes short RNA sequences that serve as a starting point for DNA replication. It is important to note that primase synthesizes RNA, not DNA, as mentioned in the question.

Submit
85. Which of the following is most likely to cause a frameshift mutation?

Explanation

Intercalating agents are molecules that can insert themselves between the base pairs of DNA, causing the DNA strands to separate and leading to the addition or deletion of nucleotides during replication. This disruption in the reading frame of the DNA sequence results in a frameshift mutation. Base analogs can cause point mutations by substituting one base for another, alkylating agents can cause DNA damage by adding alkyl groups to nucleotides, ionizing radiation can cause DNA breaks and UV light can cause the formation of thymine dimers, but none of these directly cause frameshift mutations like intercalating agents do.

Submit
86. Mendel crossed purebred wrinkled, green-seeded plants with purebred round, yellow-seeded plants.  Round seeds are recessive to wrinkled, and yellow seeds are recessive to green. The F1 progeny were self-crossed.  Which of the following numbers are most likely to result from this cross.

Explanation

In this question, the traits for seed shape and seed color are both controlled by two different pairs of alleles, with round and yellow being dominant and wrinkled and green being recessive. When purebred wrinkled, green-seeded plants are crossed with purebred round, yellow-seeded plants, the F1 progeny will all be heterozygous for both traits (RrYy). When the F1 progeny are self-crossed, the possible genotypes and phenotypes can be determined using Punnett squares. The most likely outcome is 11 plants with round, yellow seeds (RRYY), 26 plants with round, green seeds (RRYy), 27 plants with wrinkled, yellow seeds (rrYY), and 87 plants with wrinkled, green seeds (rrYy).

Submit
87. In an interacting gene pair, the gene whose expression is masked by another gene is the         gene.

Explanation

In an interacting gene pair, the gene whose expression is masked by another gene is called the hypostatic gene. This means that the hypostatic gene's effects are suppressed or overridden by the other gene in the pair.

Submit
88. If the sequence of a nontemplate strand of DNA is 5’-ACCGCATCCGAGTCAC-3’, what is the sequence of the primary product of transcription?

Explanation

The correct answer is 5’-ACCGCAUCCGAGUCAC-3’. In transcription, the DNA sequence is used as a template to produce a complementary RNA molecule. The RNA molecule is synthesized in the 5’ to 3’ direction, matching the DNA sequence with the exception that thymine (T) is replaced with uracil (U). Therefore, the sequence of the primary product of transcription would be the same as the nontemplate strand of DNA, but with T replaced by U. In this case, the nontemplate strand is 5’-ACCGCATCCGAGTCAC-3’, and the correct answer, 5’-ACCGCAUCCGAGUCAC-3’, matches this pattern.

Submit
89. Which element of the lac operon can act in cis or trans?

Explanation

The I gene in the lac operon can act in cis or trans. This means that the I gene can act on the same DNA molecule (cis) or on a different DNA molecule (trans). The I gene encodes for the repressor protein that binds to the operator region of the lac operon. When the repressor protein is bound to the operator, it prevents the transcription of the structural genes involved in lactose metabolism.

Submit
90. The recombination frequency between three genes can be used to calculate

Explanation

The recombination frequency between three genes can be used to calculate the gene order. Recombination frequency is a measure of how often recombination occurs between two genes during meiosis. By determining the frequency of recombination between three genes, their relative positions on a chromosome can be inferred, allowing the determination of the gene order.

Submit
91. Which of the following enzymes initiate chain synthesis on a template during replication? 

Explanation

Primase is the correct answer because it is an enzyme that synthesizes RNA primers during DNA replication. These RNA primers serve as starting points for DNA synthesis by DNA polymerases. DNA pol I, DNA pol II, and DNA pol III are DNA polymerases that are involved in DNA replication but do not initiate chain synthesis. RNA pol II is an enzyme involved in transcription, not replication.

Submit
92. Enzyme involved in transcription of tRNA

Explanation

RNA Polymerase III is the correct answer because it is the enzyme involved in the transcription of tRNA. RNA polymerases are responsible for synthesizing RNA molecules from a DNA template during transcription. RNA Polymerase III specifically transcribes small non-coding RNAs, including tRNA, which are essential for protein synthesis. DNA Polymerase I is involved in DNA replication and repair, while RNA Polymerase II is responsible for transcribing protein-coding genes. Aminoacyl transferase is not directly involved in transcription but plays a role in attaching amino acids to tRNA molecules during protein synthesis.

Submit
93.                  contains an RNA molecule which is required for function.

Explanation

Telomerase is the correct answer because it contains an RNA molecule that is required for its function. Telomerase is an enzyme that adds repetitive nucleotide sequences to the ends of chromosomes, called telomeres. These telomeres protect the chromosomes from degradation and prevent the loss of important genetic information during DNA replication. Telomerase contains an RNA component that serves as a template for the addition of these telomere sequences, allowing the enzyme to extend the telomeres and maintain the integrity of the chromosomes.

Submit
94. Phosphorylation of pRB is carried out by?

Explanation

CDK4/cyclin D is responsible for the phosphorylation of pRB. Cyclin D binds to CDK4 and together they form a complex that phosphorylates pRB. This phosphorylation of pRB leads to the release of E2F, a transcription factor that promotes cell cycle progression. Therefore, CDK4/cyclin D is the correct answer for the question.

Submit
95. During replication, primase adds an RNA primer to DNA.

Explanation

During replication, primase adds an RNA primer to DNA. This statement is false. Primase is an enzyme that synthesizes a short RNA primer, not an RNA primer itself. The RNA primer is then used as a starting point for DNA synthesis by DNA polymerase. Therefore, primase does not directly add an RNA primer to DNA, but rather synthesizes it.

Submit
96. Given the sequence 5’-AGTTACCTGA-3’ what would be the sequence of the complementary DNA strand?

Explanation

The complementary DNA strand is formed by pairing each nucleotide with its complementary base. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, in the given sequence 5’-AGTTACCTGA-3’, the complementary DNA strand would be 5’-TCAGGTAACT-3’.

Submit
97. In a pea plant that is heterozygous for seed color, what proportion of gametes will carry the recessive allele?

Explanation

In a pea plant that is heterozygous for seed color, the genotype would be represented as Ss, where S is the dominant allele for seed color and s is the recessive allele. During gamete formation, each parent will randomly pass on one allele to the offspring. Since the plant is heterozygous, it can produce two types of gametes: one with the dominant allele (S) and one with the recessive allele (s). Therefore, the proportion of gametes carrying the recessive allele is 1 out of 3, or 1/3.

Submit
98. The chromosome theory of inheritance states that 

Explanation

The chromosome theory of inheritance, formulated by Walter Sutton and Theodor Boveri, integrates the principles of Mendelian genetics with the behavior of chromosomes during meiosis. The theory specifically emphasizes that:

Genes are located on chromosomes.

Chromosomes segregate independently and randomly assort during meiosis, which explains how alleles (different versions of a gene) segregate and why offspring receive one allele from each parent for each gene.

Submit
99. Before a prokaryotic mRNA can be translated, it must be modified by the 

Explanation

The correct answer is "none of the above". This is because prokaryotic mRNA does not undergo the same modifications as eukaryotic mRNA. Prokaryotic mRNA does not have a 5' cap or a polyA tail, and it also does not contain introns. Therefore, none of the modifications mentioned in the options are required for prokaryotic mRNA translation.

Submit
100. The term used to describe genes that are evolutionarily related is?

Explanation

The term "All of the above" is the correct answer because paralogs, orthologs, and homologs are all used to describe genes that are evolutionarily related. Paralogs are genes that arise from gene duplication within a species, orthologs are genes that are present in different species and share a common ancestor, and homologs are genes that share a common ancestry. Therefore, all three terms are used to describe genes that are evolutionarily related.

Submit
×
Saved
Thank you for your feedback!
View My Results
Cancel
  • All
    All (100)
  • Unanswered
    Unanswered ()
  • Answered
    Answered ()
G and U are present in both DNA and RNA
The basic structure of nucleotide includes the following components
Introns are removed from precursor mRNAs by spliceosomes
Frameshift mutations generally have more drastic ...
________ results when chromatids fail to ...
Typically, a small subset of genes are expressed in each type of cell...
The appearance of traits expressed by genes in association with...
                opens the...
For ...
Proto-oncogenes are found in normal, non-cancerous cells and ...
The primary structure of a protein is determined by
In ...
All RNAs are translated.
A Barr body is an
What is the name for the statistical measure used to ...
A purine’s being replaced by a different purine ...
Regulation of the lac operon of E. coli by ...
Given ...
An organism's complete set of genes is called its 
At the conclusion of meiosis, there are ________ cells
A(n)               ...
DNA-dependent DNA polymerase
Nonsense mutations do not alter DNA sequence information.
The genetic material of eukaryotic cells is duplicated during which...
Chromatin contains
The mating system in E.coli is known as?
Most genes in prokaryotes and eukaryotes are ...
A eukaryotic promoter contains a Pribnow box
If the percentage of uracil in a double-stranded ...
In a double-stranded RNA molecule of 10,000 base ...
Plasmids that can confer the ability to conjugate are known as?
The ratio of (A+G) to (T+C) in a ...
DNA synthesis in eukaryotes is?
That ...
Chromosomal inversions result in duplications and deletions
Crossing ...
Enzyme that charges tRNAs
For a species with a diploid number of 18 chromosomes, how many...
Proto-oncogenes cause cancer.
Bacterial Recombination requires?
                relieves...
An ...
Which of the following is a nonhistone protein found ...
The transfer of bacterial genes from one cell to another requires?
In ...
In human males, genes on the X chromosome are
In the absence of glucose, the CAP protein binds ...
Which of the following groups of proteins is NOT commonly known to...
If the sequence of an RNA molecule is 5’-GGCAUCGACG-3’, what is...
Which of the following is not different between eukaryotic and...
When one speaks of a 5' cap, one is usually describing?
Which of the following statements about an ...
   ??       speciation is initiated...
A man with blood type A and a woman with blood type B could never...
The phenomenon of crossovers in nearby regions is called
The codon for methionine appears only at the ...
The two major components of Tobacco Mosaic Virus are?
Hershey and Chase differentiated between DNA and protein by:
Homologous genes in the same organism are called?
A ...
                removes...
Enzyme involved in transcription of mRNA
For most protein-encoding genes, the synonymous rate ...
Messenger RNA is usually polycistronic in eukaryotes
In catabolite repression of the lac operon, glucose affects most ...
In ...
The sugar ribose differs from ...
The genetic code is said to be “degenerate” because 
Which of the following codon pairs specify amino acids
Homologous genes found in different ...
Which of the following must exist within a ...
Proteins are composed of strings of nucleotides ...
Which of the following statements is true:
A wingless fruit fly is isolated from a population after exposure of...
The ratio of (A+T) to (G+C) in a double-stranded DNA ...
The presence of a single mutated gene is ...
Given ...
The correct order of activity in replication is
Which event is not normally associated with development of cancer?
) ...
    ??      speciation arises in...
An allopolyploid consists of more than 2 haploid sets of chromosomes, ...
Assume that a cross is made between tall and dwarf tobacco ...
               actually...
Which of the following is most likely to cause a frameshift mutation?
Mendel ...
In an interacting gene pair, the gene whose expression is masked by...
If ...
Which element of the lac operon can act in cis or trans?
The recombination frequency between three genes can ...
Which of the following enzymes initiate chain synthesis on a template...
Enzyme involved in transcription of tRNA
              ...
Phosphorylation of pRB is carried out by?
During replication, primase adds an RNA primer to DNA.
Given the sequence 5’-AGTTACCTGA-3’ what would be the ...
In a pea plant that is heterozygous for seed color, what proportion of...
The chromosome theory of inheritance states that 
Before ...
The term used to describe genes that are evolutionarily related is?
Alert!

Advertisement