Chemistry Test 2012 #4
(43).webp "Chemistry Test 2012 #4 - Quiz")
- 1.
The correct notation for the reduced form of nicotinamide adenine dinucleotide is:
- A.
NAD+
- B.
NAD
- C.
NADH
- D.
NADH2
Correct Answer
C. NADHExplanation
NADH is the correct notation for the reduced form of nicotinamide adenine dinucleotide. NADH is formed when NAD+ gains two electrons and a hydrogen ion (H+) during a redox reaction. This reduction process converts NAD+ into NADH, which carries the electrons and hydrogen ions to the electron transport chain in cellular respiration for ATP production. The "+H" in NADH represents the addition of the hydrogen ion, indicating its reduced state.Rate this question:
-
- 2.
Catabolic processes...
- A.
Are synthetic
- B.
Produce ADP
- C.
Produce NAD
- D.
Produce ATP
Correct Answer
D. Produce ATPExplanation
Catabolic processes refer to the breakdown of molecules into simpler forms, releasing energy in the process. These processes involve the breaking down of complex molecules such as carbohydrates, fats, and proteins. One of the main purposes of catabolic processes is to produce ATP (adenosine triphosphate), the primary energy currency of cells. ATP is synthesized during cellular respiration, where the energy released from the breakdown of glucose and other molecules is used to generate ATP. Therefore, the correct answer is "Produce ATP".Rate this question:
-
- 3.
Which of the following statements is false?
- A.
Synthetic and degradative pathways are distinct and separate pathways
- B.
Each pathway has one or more rate-limiting reactions
- C.
The rate-limiting reactions in a metabolic pathway are catalyzed by allosteric enzymes
- D.
The reaction curve displaying the kinetics of allosteric enzymes are hyperbolic
Correct Answer
D. The reaction curve displaying the kinetics of allosteric enzymes are hyperbolicExplanation
The statement "The reaction curve displaying the kinetics of allosteric enzymes are hyperbolic" is false. The kinetics of allosteric enzymes are not always displayed by a hyperbolic curve. Allosteric enzymes can exhibit sigmoidal kinetics, where the initial reaction rate is slow and then increases rapidly before reaching a maximum. This is due to the cooperative binding of substrate molecules to the enzyme's active sites.Rate this question:
-
- 4.
Which of the following is true?
- A.
NAD yields 3 ATP via oxidative phosphorylation pathway
- B.
FAD yields 2 ATP via oxidative phosphorylation pathway
- C.
NADH yields 3 ATP via oxidative phosphorylation pathway
- D.
FADH yields 2 ATP via oxidative phosphorylation pathway
Correct Answer
C. NADH yields 3 ATP via oxidative phosphorylation pathwayExplanation
NADH yields 3 ATP via oxidative phosphorylation pathway because it carries electrons from the citric acid cycle to the electron transport chain, where the electrons are passed along a series of protein complexes. This process generates a proton gradient, which drives the synthesis of ATP through ATP synthase. Each NADH molecule that enters the electron transport chain can generate enough energy to produce 3 ATP molecules.Rate this question:
-
- 5.
The net summary reaction written below represents: Acetyl CoA + 3NAD+ + FAD + GDP + pi + 2H2O ---> 2CO2 + 3NADH + FADH2 + GTP + 2H + CoA
- A.
Fatty acid cycle
- B.
Citric acid cycle
- C.
Catabolic
- D.
Anabolic
- E.
Only b and c
- F.
Only a and d
Correct Answer
E. Only b and cExplanation
The net summary reaction represents the Citric acid cycle, which is a series of chemical reactions that occur in the mitochondria of cells. This cycle plays a crucial role in the metabolism of carbohydrates, fats, and proteins, generating energy-rich molecules such as NADH, FADH2, and GTP. The reaction involves the breakdown of Acetyl CoA and the production of carbon dioxide, NADH, FADH2, GTP, and CoA. This process is catabolic, meaning it involves the breakdown of molecules to release energy. Therefore, the correct answer is "Citric acid cycle" and "Catabolic".Rate this question:
-
- 6.
An inhibitor of an allosteric enzyme would change the reaction curve #3 in which direction? ( Refer to test)
- A.
To the left decreasing Km
- B.
To the right decreasing Km
- C.
To the left increasing Km
- D.
To the right increasing Km
Correct Answer
D. To the right increasing KmExplanation
An inhibitor of an allosteric enzyme would change the reaction curve #3 to the right, increasing Km. This means that the inhibitor would decrease the affinity of the enzyme for its substrate, resulting in a higher concentration of substrate required to reach half of the maximum reaction rate. As a result, the enzyme would be less efficient in converting substrate to product, leading to an increase in Km.Rate this question:
-
- 7.
Which of the following regulatory mechanisms is best described as the covalent bonding of phosphate to a multi-enzyme cluster that results in activation or inhibition of the rate limiting rep in a metabolic pathway?
- A.
Competitive inhibition
- B.
Enzyme modulation
- C.
Non-competitive inhibition
- D.
Enzyme activity
Correct Answer
B. Enzyme modulationExplanation
Enzyme modulation is the best described regulatory mechanism in this scenario. It involves the covalent bonding of phosphate to a multi-enzyme cluster, which leads to the activation or inhibition of the rate limiting step in a metabolic pathway. This process can regulate the activity of the enzymes involved and control the overall flux of the pathway. Competitive inhibition and non-competitive inhibition do not involve covalent bonding of phosphate, and enzyme activity is a more general term that does not specifically describe the covalent bonding of phosphate to a multi-enzyme cluster.Rate this question:
-
- 8.
Statements: 1) High-energy phosphate compounds contain one or more strained bonds that release above-average amounts of energy when broken. 2) In the electron Transport Chain, NADH is oxidized to NAD+ 3) The "fuel" for the citric acid cycle is acetyl CoA
- A.
All three statements are true
- B.
Two of these statements are true
- C.
Two of these statements are false
- D.
One of these statements are true
- E.
None of these statements are true
Correct Answer
A. All three statements are trueExplanation
The given answer states that all three statements are true. This means that each of the statements mentioned in the question is accurate. The first statement explains that high-energy phosphate compounds contain strained bonds that release more energy than usual when broken. The second statement states that in the electron transport chain, NADH is oxidized to NAD+. Lastly, the third statement states that acetyl CoA serves as the "fuel" for the citric acid cycle. Since all three statements are true, the answer is that all three statements are true.Rate this question:
-
- 9.
Identify the unique property/characteristic of allosteric enzymes in comparison to other enzymes.
- A.
Globular proteins
- B.
Affect rate of reactions
- C.
Have a quaternary structure
- D.
Activity dependant on pH
Correct Answer
C. Have a quaternary structureExplanation
Allosteric enzymes have a quaternary structure, which means they are composed of multiple subunits. This is a unique property compared to other enzymes, which typically have a simpler structure. The quaternary structure allows allosteric enzymes to have multiple binding sites, including the active site and allosteric sites. These allosteric sites can bind to molecules that regulate the enzyme's activity, either enhancing or inhibiting it. This regulation mechanism enables allosteric enzymes to respond to changes in the cell's environment and adjust their activity accordingly, making them highly adaptable and efficient in controlling metabolic pathways.Rate this question:
-
- 10.
A) Glucose + phosphate --> Glucose 6-phosphate DeltaG = +3.3 kcal/mol B) ATP ---> ADP + phosphate DeltaG = -7.3 kcal/mol What reaction is endergonic and enodothermic?
- A.
A
- B.
B
Correct Answer
A. AExplanation
The reaction in option A, Glucose + phosphate -> Glucose 6-phosphate, has a positive deltaG value of +3.3 kcal/mol. A positive deltaG indicates that the reaction is endergonic, meaning it requires energy input to proceed. Additionally, since the reaction requires energy input, it is also endothermic. Therefore, option A is the correct answer.Rate this question:
-
- 11.
A) Glucose + phosphate --> Glucose 6-phosphate DeltaG = +3.3 kcal/mol B) ATP ---> ADP + phosphate DeltaG = -7.3 kcal/mol Which of the above reactions is spontaneous and exothermic?
- A.
A
- B.
B
Correct Answer
B. BExplanation
The reaction B) ATP --> ADP + phosphate has a negative deltaG value of -7.3 kcal/mol. A negative deltaG indicates that the reaction is spontaneous and exothermic.Rate this question:
-
- 12.
A) Glucose + phosphate --> Glucose 6-phosphate DeltaG = +3.3 kcal/mol B) ATP ---> ADP + phosphate DeltaG = -7.3 kcal/mol What is the net DG (kcal/mol) in the coupling reactions?
- A.
+ 10.6
- B.
- 4
- C.
- 7.3
- D.
+ 3.3
Correct Answer
B. - 4Explanation
In this question, we are given the delta G values for two reactions. The first reaction is the conversion of glucose and phosphate to glucose 6-phosphate, with a delta G of +3.3 kcal/mol. The second reaction is the conversion of ATP to ADP and phosphate, with a delta G of -7.3 kcal/mol.
To find the net delta G in the coupling reactions, we need to add the delta G values of the two reactions together. +3.3 + (-7.3) = -4 kcal/mol. Therefore, the correct answer is -4.Rate this question:
-
- 13.
The process of transferring electrophoreses RNA out of a gel and onto a special nylon membrane is referred to as:
- A.
Southern blotting
- B.
PCR
- C.
Northern blotting
- D.
Western blotting
- E.
Eastern blotting
- F.
Transferring unimportant material that doesn't matter
Correct Answer
C. Northern blottingExplanation
Northern blotting is the process of transferring electrophoresed RNA out of a gel and onto a special nylon membrane. This technique allows for the detection and analysis of specific RNA molecules, such as mRNA, by using complementary DNA or RNA probes. It is commonly used in molecular biology research to study gene expression and identify RNA transcripts. Southern blotting, on the other hand, is used for the detection of specific DNA sequences, while PCR is a method for amplifying DNA. Western blotting is used to detect specific proteins, and Eastern blotting is not a recognized technique.Rate this question:
-
- 14.
Which of the following statements most accurately reflects the action of Bacterial restriction enzyme?
- A.
Cut a strand of DNA at specific locations.
- B.
Cut both strands of DNA to yield a set of double stranded DNA with single stranded sticky ends.
- C.
Cut both strands of DNA to yield two fragments of single stranded DNA.
- D.
Cut RNA strands at specific locations
Correct Answer
B. Cut both strands of DNA to yield a set of double stranded DNA with single stranded sticky ends.Explanation
Bacterial restriction enzymes are enzymes that recognize specific DNA sequences and cut the DNA at those locations. This action results in the formation of double-stranded DNA fragments with single-stranded sticky ends. These sticky ends can then be used for various molecular biology techniques such as DNA cloning and gene manipulation. Therefore, the statement "Cut both strands of DNA to yield a set of double stranded DNA with single stranded sticky ends" accurately reflects the action of bacterial restriction enzymes.Rate this question:
-
- 15.
Which double-stranded molecule has the highest melting temperature?
- A.
An oligonucleotide with repeating sequence of A-A-A at the 5' end
- B.
A molecule of 5,000 base pairs with a high number of A-T base pairs
- C.
An oligonucleotide with repeating sequences of C-G-C codons
- D.
A DNA polymer of 100,000 base pairs
Correct Answer
C. An oligonucleotide with repeating sequences of C-G-C codonsExplanation
The melting temperature of a double-stranded molecule is determined by the stability of the hydrogen bonds between the two strands. C-G base pairs form three hydrogen bonds, while A-T base pairs form only two. Therefore, a molecule with repeating sequences of C-G-C codons will have more stable hydrogen bonds and a higher melting temperature compared to the other options.Rate this question:
-
- 16.
In blotting techniques, what procedure is used to prevent the probe from binding to the nitrocellulose?
- A.
Nitrocellulose is soaked in blocking solution which contains DNA, RNA or protein
- B.
None required since probe binds only to target molecule
- C.
Electrophoresis of target molecule prior to application of probe
- D.
Antibody attached to probe identifies target molecule
Correct Answer
A. Nitrocellulose is soaked in blocking solution which contains DNA, RNA or proteinExplanation
In blotting techniques, the procedure used to prevent the probe from binding to the nitrocellulose is soaking the nitrocellulose in a blocking solution that contains DNA, RNA, or protein. This blocking solution acts as a barrier, preventing the probe from binding to the nitrocellulose and allowing it to specifically bind to the target molecule.Rate this question:
-
- 17.
The correct sequence of events during cycling in a PCR is...
- A.
Anneal, extend and denature
- B.
Denature, anneal and extend
- C.
Extend, anneal and denature
- D.
Extend, denature and anneal
Correct Answer
B. Denature, anneal and extendExplanation
During cycling in a PCR, the first step is denaturation, which involves heating the DNA to separate the double-stranded DNA into single strands. This is followed by annealing, where the temperature is lowered to allow the primers to bind to their complementary sequences on the single-stranded DNA. Finally, extension occurs, where the temperature is raised and the DNA polymerase adds nucleotides to the primers, synthesizing new DNA strands. Therefore, the correct sequence of events during cycling in a PCR is denature, anneal, and extend.Rate this question:
-
- 18.
If RNA is to be used in a PCR amplification procedure, what is the initial step that must be performed?
- A.
The RNA must be denatured to form single strands for annealing to primers
- B.
RNA shoulds never be used in a PCR reaction because thermostable enzymes cannot synthesize strands to anneal it
- C.
A reverse transcription procedure must be performs to form cDNA
- D.
RNA must first be treated with RNases to remove interfering substances from the target
Correct Answer
C. A reverse transcription procedure must be performs to form cDNAExplanation
The correct answer is that a reverse transcription procedure must be performed to form cDNA. In a PCR amplification procedure, RNA cannot be directly used as a template because the enzymes used in PCR, such as DNA polymerase, cannot synthesize strands to anneal to RNA. Therefore, the RNA is first converted into complementary DNA (cDNA) through reverse transcription. This process involves using the enzyme reverse transcriptase to synthesize a complementary DNA strand from the RNA template. This cDNA can then be used as a template for PCR amplification.Rate this question:
-
- 19.
THe process of transferring digested electrophoreses protein out of a gel and onto a nylon membrane is referred to as:
- A.
Southern blotting
- B.
Northern blotting
- C.
Western blotting
- D.
Eastern blotting
- E.
Hybridization
Correct Answer
C. Western blottingExplanation
Western blotting is the correct answer because it is the process of transferring digested electrophoresed proteins from a gel onto a nylon membrane. This technique allows for the detection and analysis of specific proteins using antibodies. Southern blotting is used to detect specific DNA sequences, Northern blotting is used to detect specific RNA sequences, and Eastern blotting is not a commonly used technique. Hybridization is a general term that refers to the process of combining two complementary nucleic acid strands.Rate this question:
-
- 20.
Identify the correct step sequences in blotting techniques.
- A.
Gel electrophoresis, blocking, transfer to solid support, preparing the probe, hybridization, washing and detection of probe.
- B.
Gel electrophoresis, transfer to solid support, washing, blocking, preparing the probe, hybridization and detection fo probe.
- C.
Gel electrophoresis, transfer to solid support, blocking, preparing the probe, blocking, hybridization, washing, detection of probe.
- D.
Gel electrophoresis, transfer to solid support, blocking, preparing the probe, hybridization, washing, detection of probe.
Correct Answer
D. Gel electrophoresis, transfer to solid support, blocking, preparing the probe, hybridization, washing, detection of probe.Explanation
The correct step sequence in blotting techniques is as follows: Gel electrophoresis, transfer to solid support, blocking, preparing the probe, hybridization, washing, and detection of probe. This sequence ensures that the gel is transferred onto a solid support, any nonspecific binding sites are blocked, the probe is prepared and hybridized to the target molecules, any unbound probe is washed away, and the probe is detected to visualize the target molecules.Rate this question:
-
- 21.
Increasing agarose/acrylamide concentration in your gel will:
- A.
Allow for greater separation of lower molecular weight bands
- B.
Allow for greater separation of higher molecular weight bands
- C.
Cause all bands to migrate faster, reducing your run time
- D.
Cause all bands to migrate slower, increasing your run time
Correct Answer
A. Allow for greater separation of lower molecular weight bandsExplanation
Increasing agarose/acrylamide concentration in the gel will allow for greater separation of lower molecular weight bands. This is because higher concentrations of agarose/acrylamide create a denser gel matrix, which slows down the migration of larger molecules. As a result, smaller molecules can move more easily through the gel, leading to better separation of lower molecular weight bands.Rate this question:
-
- 22.
A gel loading standard is used to:
- A.
Increase the electrical charge of your sample
- B.
Mark the locations of known molecular weights
- C.
Determine if samples were loaded evenly across the wells
- D.
Denature your sample
Correct Answer
B. Mark the locations of known molecular weightsExplanation
A gel loading standard is used to mark the locations of known molecular weights. This is important in gel electrophoresis, as it allows researchers to compare the migration of their samples to the migration of the standard. By knowing the molecular weights of the standard bands, they can estimate the molecular weights of their samples based on their migration distances. This helps in determining the size or weight of the molecules being analyzed.Rate this question:
-
- 23.
A gel loading control is used to:
- A.
Increase the electrical charge of your sample
- B.
Mark the locations of known molecular weights
- C.
Determine if samples were loaded evenly across wells
- D.
Denature your sample
Correct Answer
C. Determine if samples were loaded evenly across wellsExplanation
A gel loading control is used to determine if samples were loaded evenly across wells. This control is typically a known molecular weight marker that is loaded alongside the experimental samples. By comparing the intensity of the loading control bands across the wells, one can assess if the samples were loaded in equal amounts. This helps to ensure accurate and reliable results in gel electrophoresis experiments.Rate this question:
-
- 24.
Running a gel for less time than required could:
- A.
Cause your sample to renature
- B.
Cause your sample to run off the edge of the gel
- C.
Affect blocking stage
- D.
Decrease the amount of separation between bands
Correct Answer
D. Decrease the amount of separation between bandsExplanation
Running a gel for less time than required will decrease the amount of separation between bands. The separation of bands on a gel is dependent on the size and charge of the molecules being analyzed. Running the gel for a shorter time will not allow enough time for the molecules to migrate through the gel matrix, resulting in less separation between the bands. This can make it difficult to distinguish and analyze different molecules in the sample.Rate this question:
-
- 25.
The illustration below highlightes in bold from the DNA section that needs to be amplified by the PCR. 5' GCAATTCTGCAAGCTTAGCCGATGCTAGCCCAAGTAC 3' 3' CGTTAAGACGTTCGAATCGGCTACGATCGGGTTCATG 5' Which of the following set of primers would you use for the PCR
- A.
3' GGUU 5' and 5' CUUAG 3'
- B.
3' GGGTT 5' and 5' CTTAG 3'
- C.
5' GGGTT 3' and 3' CTTAG 5'
- D.
3' GGGTT 5' and 3' CTTAG 5'
Correct Answer
B. 3' GGGTT 5' and 5' CTTAG 3'Explanation
The correct answer is 3' GGGTT 5' and 5' CTTAG 3'. This is because the primers should be complementary to the target DNA sequence that needs to be amplified. In this case, the target DNA sequence is highlighted in bold in the given illustration. By comparing the target DNA sequence with the options provided, it can be seen that the primer sequences in the correct answer are complementary to the target DNA sequence, allowing for efficient amplification of the desired DNA fragment during PCR.Rate this question:
-
- 26.
When transferring sample from a gel to a nitrocellulose membrane....
- A.
The nitrocellulose membrane must be on the positive electrode side of the gel
- B.
The nitrocellulose membrane must be on the negative elect role side of the gel
- C.
The sample will always transfer to the nitrocellulose membrane regardless of orientation
- D.
All molecular width bands will always transfer to the nitrocellulose membrane
Correct Answer
A. The nitrocellulose membrane must be on the positive electrode side of the gelExplanation
The correct answer is that the nitrocellulose membrane must be on the positive electrode side of the gel. This is because during the transfer process, the negatively charged molecules in the gel will migrate towards the positive electrode. Placing the nitrocellulose membrane on the positive side ensures that the molecules will transfer onto the membrane for further analysis. If the membrane is placed on the negative side, the molecules will not transfer properly.Rate this question:
-
- 27.
Which formula predicts the number of PCR products that can be produced?
- A.
N4 where N is the number of cycles
- B.
N2/2 where N is the number of cycles
- C.
P2 + 2PQ + Q2=1 Where P and Q are the number of primers
- D.
2n where n is the number of cycles
Correct Answer
D. 2n where n is the number of cyclesExplanation
The formula 2n predicts the number of PCR products that can be produced, where n is the number of cycles. This formula suggests that the number of PCR products doubles with each cycle. Therefore, if there are n cycles, the number of PCR products will be 2n.Rate this question:
-
- 28.
During replication, the continuous addition of bases occurs:
- A.
In the 5' to 3' direction
- B.
In the 3' to 5' direction
- C.
In both directions
- D.
Only at the methylated end of DNA strands
Correct Answer
A. In the 5' to 3' directionExplanation
During replication, the continuous addition of bases occurs in the 5' to 3' direction. This is because DNA polymerase can only add nucleotides to the 3' end of an existing DNA strand. The 5' to 3' direction refers to the orientation of the DNA molecule, where the 5' end has a phosphate group attached to the 5th carbon of the sugar molecule, and the 3' end has a hydroxyl group attached to the 3rd carbon. Therefore, new nucleotides are added to the growing DNA strand in the 5' to 3' direction, resulting in a continuous replication process.Rate this question:
-
- 29.
How can PCR be applied to the detection of human immunodeficiency and other RNA viruses?
- A.
The virus must be inserted into hman DNA by viral integrate prior to PCR
- B.
Substituted deoxyuridine triphosphate in place of deoxythymidine triphosphate in the master mix
- C.
Add heat-stable reverse transcriptase enzymes to the master mix
- D.
Substitute ribonucleotide triphosphates for deoxyribonucleotide triphosphates in the master mix
Correct Answer
C. Add heat-stable reverse transcriptase enzymes to the master mixExplanation
PCR (Polymerase Chain Reaction) is a technique used to amplify specific DNA sequences. However, in the case of RNA viruses like human immunodeficiency virus (HIV), which have RNA as their genetic material, an additional step is required. The RNA must first be converted into complementary DNA (cDNA) using an enzyme called reverse transcriptase. This cDNA can then be amplified using PCR. Therefore, in order to apply PCR to the detection of RNA viruses, heat-stable reverse transcriptase enzymes need to be added to the PCR master mix to convert the RNA into cDNA before the amplification step.Rate this question:
-
- 30.
What term best describes the products proceeds when DNA is digested by restriction endonucleases?
- A.
Mosaicisms
- B.
Chimeras
- C.
Amplicons
- D.
Restriction fragment length polymorphisms
Correct Answer
D. Restriction fragment length polymorphismsExplanation
Restriction fragment length polymorphisms (RFLPs) is the best term to describe the products proceeds when DNA is digested by restriction endonucleases. RFLPs refer to the variations in the lengths of DNA fragments that are produced when a specific DNA sequence is cut by restriction enzymes. These variations can be used to analyze genetic differences and identify individuals or species. Therefore, RFLPs accurately describe the products generated by digestion with restriction endonucleases.Rate this question:
-
- 31.
The required reagents for PCR are:
- A.
Template DNA, an oligonucleotide primer, nucleosides in excess
- B.
Template DNA, two oligonucleotide primer, nucleosides in excess, Taq polymerase
- C.
Template DNA, two oligonucleotide primer, nucleotides in excess, Taq polymerase
- D.
Template DNA, Two oligonucleotide primers in excess, nucleosides in excess, Taq polymerase
Correct Answer
C. Template DNA, two oligonucleotide primer, nucleotides in excess, Taq polymeraseExplanation
The correct answer is "Template DNA, two oligonucleotide primer, nucleotides in excess, Taq polymerase." PCR (Polymerase Chain Reaction) is a technique used to amplify a specific DNA sequence. The template DNA serves as the starting material, the two oligonucleotide primers bind to the target sequence, the nucleotides provide the building blocks for DNA synthesis, and Taq polymerase is the enzyme responsible for DNA replication.Rate this question:
-
- 32.
RT-PCR is the monitoring of the accumulation of amplified amplicons as they are being generated in the PCR reaction. The essential reagent required is?
- A.
Single stranded DNA probe that binds between two primers which is labeled with fluorophore
- B.
DOuble stranded DNA probe that binds between the two primers which is labelled with a fluorescent quencher
- C.
Single stranded DNA probe that binds between the two primers which is labeled with a fluorophore and a fluorescent quencher
- D.
DOuble stranded DNA probe that binds between the two primers which is labeled with a fluorescent quencher and a fluorophore
Correct Answer
C. Single stranded DNA probe that binds between the two primers which is labeled with a fluorophore and a fluorescent quencherExplanation
The correct answer is a single-stranded DNA probe that binds between the two primers, which is labeled with a fluorophore and a fluorescent quencher. This probe is essential in RT-PCR because it allows for the monitoring of the accumulation of amplified amplicons. The fluorophore emits light when excited, while the quencher suppresses the fluorescence. When the probe binds to the target DNA sequence during the PCR reaction, the fluorophore and quencher are brought into close proximity, resulting in fluorescence suppression. As the amplicons are generated, the probe is cleaved, separating the fluorophore from the quencher and allowing fluorescence to be detected, indicating amplification.Rate this question:
-
- 33.
Steroid hormones exert their action by:
- A.
Cross the plasma membrane and bind to cytoplasmic receptors
- B.
Cross plasma membrane and bind to nuclear receptors initiating or altering the expression of a gene
- C.
Bind to the receptors located on the plasma membrane and initiate a secondary messenger
- D.
Active transport across the plasma membrane and attach to cytoplasmic protein receptors
Correct Answer
A. Cross the plasma membrane and bind to cytoplasmic receptorsExplanation
Steroid hormones are lipid-soluble molecules that can easily cross the plasma membrane. Once inside the cell, they bind to specific receptors located in the cytoplasm. This hormone-receptor complex then enters the nucleus and binds to specific DNA sequences, either activating or inhibiting the expression of target genes. This process allows steroid hormones to directly regulate gene expression and initiate cellular responses. Therefore, the correct answer is that steroid hormones cross the plasma membrane and bind to cytoplasmic receptors.Rate this question:
-
- 34.
In which of the following categories is ATCH classified?
- A.
Amine
- B.
Steroid
- C.
Protein/polypeptide
- D.
Glucocoritco steroid
Correct Answer
C. Protein/polypeptideExplanation
ATCH is classified under the category of Protein/polypeptide.Rate this question:
-
- 35.
Because of the biochemical properties of steroid hormones, the majority of these hormones at physiological concentrations...
- A.
Are bound with a high affinity to a carrier protein in the circulation
- B.
Remain free in the circulation
- C.
Are conjugated to glucuronides
- D.
Are bound with low affinity to albumin
Correct Answer
A. Are bound with a high affinity to a carrier protein in the circulationExplanation
Steroid hormones have a high affinity for carrier proteins in the circulation due to their biochemical properties. This binding allows for the hormones to be transported through the bloodstream, protecting them from degradation and increasing their solubility. It also helps to regulate the availability and activity of the hormones in target tissues. Therefore, the majority of steroid hormones at physiological concentrations are bound with a high affinity to carrier proteins in the circulation.Rate this question:
-
- 36.
The thyroid gland produces all of the following hormone except:
- A.
Thryroxine
- B.
Calcitonin
- C.
TSH
- D.
Triiodothyronine
Correct Answer
C. TSHExplanation
TSH stands for thyroid-stimulating hormone, which is not produced by the thyroid gland itself. Instead, it is produced by the pituitary gland and acts on the thyroid gland to stimulate the production of thyroxine and triiodothyronine. Therefore, TSH is not produced by the thyroid gland, making it the correct answer.Rate this question:
-
- 37.
If a patient was given TRH, which of the following test results would be expected normal in a healthy individual?
- A.
Increase FT4, decreased TSH
- B.
Decreased TSH, increased FT4
- C.
Increased FT4, increased TSH
- D.
Increased TSH, decreased FT4
Correct Answer
C. Increased FT4, increased TSHExplanation
When a patient is given TRH (thyrotropin-releasing hormone), it stimulates the release of thyroid-stimulating hormone (TSH) from the pituitary gland. TSH then acts on the thyroid gland to promote the production and release of thyroid hormones, including thyroxine (T4). In a healthy individual, the administration of TRH would lead to an increase in both FT4 (free thyroxine) and TSH levels. This is because the increased TSH would stimulate the thyroid gland to produce more T4, resulting in increased FT4 levels. Therefore, the expected normal test results in a healthy individual after receiving TRH would be increased FT4 and increased TSH.Rate this question:
-
- 38.
Chemical signalling affecting neighbouring cells is defined as:
- A.
Intracrine
- B.
Paracrine
- C.
Autocrine
- D.
Endocrine
Correct Answer
B. ParacrineExplanation
Paracrine signaling refers to the process in which cells secrete signaling molecules that affect nearby cells. These signaling molecules, known as paracrine factors, are released into the extracellular space and act on neighboring cells by binding to specific receptors on their surface. This type of signaling is important for local communication between cells within a tissue or organ, allowing for coordination of various cellular processes. Unlike endocrine signaling, which involves the release of signaling molecules into the bloodstream to affect distant cells, paracrine signaling specifically targets nearby cells. Autocrine signaling, on the other hand, involves cells responding to signaling molecules that they themselves secrete. Intracrine signaling refers to the process in which signaling molecules act within the same cell that produced them.Rate this question:
-
- 39.
Protein hormones bind to receptors located...
- A.
On nucleoproteins
- B.
On cytoplasmic recptors
- C.
On plasma membrane
- D.
Circulating carrier proteins
Correct Answer
C. On plasma membraneExplanation
Protein hormones bind to receptors located on the plasma membrane. This is because the plasma membrane is the outermost layer of the cell and contains various receptors that can recognize and bind to specific molecules, including protein hormones. Binding of the hormone to its receptor on the plasma membrane triggers a signaling cascade within the cell, leading to various cellular responses. This allows for efficient communication between cells and the regulation of physiological processes.Rate this question:
-
- 40.
Which of the following enzymes is used to replicated the DNA strands in PCR?
- A.
DNA polymerase
- B.
Taq RNA polymerase
- C.
RNA polymerase
- D.
Taq DNA polymerase
Correct Answer
D. Taq DNA polymeraseExplanation
Taq DNA polymerase is the correct answer because it is the enzyme commonly used in PCR (Polymerase Chain Reaction) to replicate DNA strands. Taq DNA polymerase is derived from the thermophilic bacterium Thermus aquaticus, which can withstand the high temperatures required for PCR. It has a high processivity and can efficiently amplify DNA by adding nucleotides to the growing DNA strand. Taq DNA polymerase is also heat-stable, allowing it to withstand the denaturation step of PCR where the DNA strands are separated. Therefore, Taq DNA polymerase is the enzyme of choice for DNA replication in PCR.Rate this question:
-
- 41.
Increasing agarose/acrylamide concentration in your gel will:
- A.
Allow for greater separation of lower molecular weight bands
- B.
Allow for greater separation of higher molecular weight bands
- C.
Cause all bands to migrate faster, reducing your run time
- D.
Cause all bands to migrate slower, increasing your run time
Correct Answer
A. Allow for greater separation of lower molecular weight bandsExplanation
Increasing the agarose/acrylamide concentration in the gel will allow for greater separation of lower molecular weight bands. This is because higher gel concentration provides a tighter matrix, which hinders the movement of larger molecules and allows smaller molecules to migrate more freely through the gel. As a result, the lower molecular weight bands will be able to move further and separate more effectively, leading to better resolution and separation.Rate this question:
-
Quiz Review Timeline +
Our quizzes are rigorously reviewed, monitored and continuously updated by our expert board to maintain accuracy, relevance, and timeliness.
-
Current Version
-
Jun 19, 2023Quiz Edited by
ProProfs Editorial Team -
Dec 08, 2012Quiz Created by
J1_black
- Aeronautics Quizzes
- Aerospace Quizzes
- Agricultural Science Quizzes
- Astrology Quizzes
- Astronomy Quizzes
- Atom Quizzes
- Biochemistry Quizzes
- Biology Quizzes
- Biomechanics Quizzes
- Biostatistics Quizzes
- Biotechnology Quizzes
- Botany Quizzes
- Branches Of Science Quizzes
- Cytology Quizzes
- Easy Science Quizzes
- Ecology Quizzes
- Electrical Quizzes
- Embryology Quizzes
- Endocrinology Quizzes
- Engineering Quizzes
- Environmental Science Quizzes
- Epidemiology Quizzes
- Experiment Quizzes
- Forestry Quizzes
- Fossil Quizzes
- Gas Quizzes
- General Science Quizzes
- Genetics Quizzes
- Histology Quizzes
- Human Biology Quizzes
- Integrated Science Quizzes
- Invention Quizzes
- Library Science Quizzes
- Lighting Quizzes
- Liquid Quizzes
- Marine Biology Quizzes
- Microbiology Quizzes
- Molecular Biology Quizzes
- Nature Quizzes
- Neuroscience Quizzes
- Nuclear Science Quizzes
- Oceanography Quizzes
- Physics Quizzes
- Psychology Quizzes
- Science And Technology Quizzes
- Science Glossary Quizzes
- Science Knowledge Quizzes
- Science Practice Quizzes
- Scientific Method Quizzes
- Scientific Notation Quizzes
- Soil Science Quizzes
- Solar System Quizzes
- Solid Quizzes
- Zoology Quizzes
Back to top