Chemistry Test 2012 #4

  • 11th Grade,
  • 12th Grade
  • AP Chem
  • MCAT
Reviewed by Editorial Team
The ProProfs editorial team is comprised of experienced subject matter experts. They've collectively created over 10,000 quizzes and lessons, serving over 100 million users. Our team includes in-house content moderators and subject matter experts, as well as a global network of rigorously trained contributors. All adhere to our comprehensive editorial guidelines, ensuring the delivery of high-quality content.
Learn about Our Editorial Process
| By J1_black
J
J1_black
Community Contributor
Quizzes Created: 6 | Total Attempts: 14,999
| Attempts: 64 | Questions: 43 | Updated: Jun 19, 2025
Please wait...
Question 1 / 44
🏆 Rank #--
Score 0/100

1. Increasing agarose/acrylamide concentration in your gel will:

Explanation

Increasing the agarose/acrylamide concentration in the gel will allow for greater separation of lower molecular weight bands. This is because higher gel concentration provides a tighter matrix, which hinders the movement of larger molecules and allows smaller molecules to migrate more freely through the gel. As a result, the lower molecular weight bands will be able to move further and separate more effectively, leading to better resolution and separation.

Submit
Please wait...
About This Quiz
Chemistry Test 2012 #4 - Quiz

Chemistry test 2012 #4 assesses knowledge of biochemical processes like oxidative phosphorylation and enzyme kinetics. Key skills tested include understanding of NADH functions, ATP production, and enzyme inhibition. Essential for learners in advanced chemistry courses.

2.

What first name or nickname would you like us to use?

You may optionally provide this to label your report, leaderboard, or certificate.

2. Running a gel for less time than required could:

Explanation

Running a gel for less time than required will decrease the amount of separation between bands. The separation of bands on a gel is dependent on the size and charge of the molecules being analyzed. Running the gel for a shorter time will not allow enough time for the molecules to migrate through the gel matrix, resulting in less separation between the bands. This can make it difficult to distinguish and analyze different molecules in the sample.

Submit

3. Chemical signalling affecting neighbouring cells is defined as:

Explanation

Paracrine signaling refers to the process in which cells secrete signaling molecules that affect nearby cells. These signaling molecules, known as paracrine factors, are released into the extracellular space and act on neighboring cells by binding to specific receptors on their surface. This type of signaling is important for local communication between cells within a tissue or organ, allowing for coordination of various cellular processes. Unlike endocrine signaling, which involves the release of signaling molecules into the bloodstream to affect distant cells, paracrine signaling specifically targets nearby cells. Autocrine signaling, on the other hand, involves cells responding to signaling molecules that they themselves secrete. Intracrine signaling refers to the process in which signaling molecules act within the same cell that produced them.

Submit

4. The correct notation for the reduced form of nicotinamide adenine dinucleotide is:

Explanation

NADH is the correct notation for the reduced form of nicotinamide adenine dinucleotide. NADH is formed when NAD+ gains two electrons and a hydrogen ion (H+) during a redox reaction. This reduction process converts NAD+ into NADH, which carries the electrons and hydrogen ions to the electron transport chain in cellular respiration for ATP production. The "+H" in NADH represents the addition of the hydrogen ion, indicating its reduced state.

Submit

5. Identify the unique property/characteristic of allosteric enzymes in comparison to other enzymes.

Explanation

Allosteric enzymes have a quaternary structure, which means they are composed of multiple subunits. This is a unique property compared to other enzymes, which typically have a simpler structure. The quaternary structure allows allosteric enzymes to have multiple binding sites, including the active site and allosteric sites. These allosteric sites can bind to molecules that regulate the enzyme's activity, either enhancing or inhibiting it. This regulation mechanism enables allosteric enzymes to respond to changes in the cell's environment and adjust their activity accordingly, making them highly adaptable and efficient in controlling metabolic pathways.

Submit

6. Which of the following statements most accurately reflects the action of Bacterial restriction enzyme?

Explanation

Bacterial restriction enzymes are enzymes that recognize specific DNA sequences and cut the DNA at those locations. This action results in the formation of double-stranded DNA fragments with single-stranded sticky ends. These sticky ends can then be used for various molecular biology techniques such as DNA cloning and gene manipulation. Therefore, the statement "Cut both strands of DNA to yield a set of double stranded DNA with single stranded sticky ends" accurately reflects the action of bacterial restriction enzymes.

Submit

7. A) Glucose + phosphate --> Glucose 6-phosphate  DeltaG = +3.3 kcal/mol B) ATP ---> ADP + phosphate DeltaG = -7.3 kcal/mol What is the net DG (kcal/mol) in the coupling reactions?

Explanation

In this question, we are given the delta G values for two reactions. The first reaction is the conversion of glucose and phosphate to glucose 6-phosphate, with a delta G of +3.3 kcal/mol. The second reaction is the conversion of ATP to ADP and phosphate, with a delta G of -7.3 kcal/mol.

To find the net delta G in the coupling reactions, we need to add the delta G values of the two reactions together. +3.3 + (-7.3) = -4 kcal/mol. Therefore, the correct answer is -4.

Submit

8. THe process of transferring digested electrophoreses protein out of a gel and onto a nylon membrane is referred to as:

Explanation

Western blotting is the correct answer because it is the process of transferring digested electrophoresed proteins from a gel onto a nylon membrane. This technique allows for the detection and analysis of specific proteins using antibodies. Southern blotting is used to detect specific DNA sequences, Northern blotting is used to detect specific RNA sequences, and Eastern blotting is not a commonly used technique. Hybridization is a general term that refers to the process of combining two complementary nucleic acid strands.

Submit

9. Protein hormones bind to receptors located...

Explanation

Protein hormones bind to receptors located on the plasma membrane. This is because the plasma membrane is the outermost layer of the cell and contains various receptors that can recognize and bind to specific molecules, including protein hormones. Binding of the hormone to its receptor on the plasma membrane triggers a signaling cascade within the cell, leading to various cellular responses. This allows for efficient communication between cells and the regulation of physiological processes.

Submit

10. A) Glucose + phosphate --> Glucose 6-phosphate  DeltaG = +3.3 kcal/mol B) ATP ---> ADP + phosphate DeltaG = -7.3 kcal/mol Which of the above reactions is spontaneous and exothermic?

Explanation

The reaction B) ATP --> ADP + phosphate has a negative deltaG value of -7.3 kcal/mol. A negative deltaG indicates that the reaction is spontaneous and exothermic.

Submit

11. A gel loading control is used to:

Explanation

A gel loading control is used to determine if samples were loaded evenly across wells. This control is typically a known molecular weight marker that is loaded alongside the experimental samples. By comparing the intensity of the loading control bands across the wells, one can assess if the samples were loaded in equal amounts. This helps to ensure accurate and reliable results in gel electrophoresis experiments.

Submit

12. When transferring sample from a gel to a nitrocellulose membrane....

Explanation

The correct answer is that the nitrocellulose membrane must be on the positive electrode side of the gel. This is because during the transfer process, the negatively charged molecules in the gel will migrate towards the positive electrode. Placing the nitrocellulose membrane on the positive side ensures that the molecules will transfer onto the membrane for further analysis. If the membrane is placed on the negative side, the molecules will not transfer properly.

Submit

13. Catabolic processes...

Explanation

Catabolic processes refer to the breakdown of molecules into simpler forms, releasing energy in the process. These processes involve the breaking down of complex molecules such as carbohydrates, fats, and proteins. One of the main purposes of catabolic processes is to produce ATP (adenosine triphosphate), the primary energy currency of cells. ATP is synthesized during cellular respiration, where the energy released from the breakdown of glucose and other molecules is used to generate ATP. Therefore, the correct answer is "Produce ATP".

Submit

14. Statements: 1) High-energy phosphate compounds contain one or more strained bonds that release above-average amounts of energy when broken. 2) In the electron Transport Chain, NADH is oxidized to NAD+ 3) The "fuel" for the citric acid cycle is acetyl CoA

Explanation

The given answer states that all three statements are true. This means that each of the statements mentioned in the question is accurate. The first statement explains that high-energy phosphate compounds contain strained bonds that release more energy than usual when broken. The second statement states that in the electron transport chain, NADH is oxidized to NAD+. Lastly, the third statement states that acetyl CoA serves as the "fuel" for the citric acid cycle. Since all three statements are true, the answer is that all three statements are true.

Submit

15. In blotting techniques, what procedure is used to prevent the probe from binding to the nitrocellulose?

Explanation

In blotting techniques, the procedure used to prevent the probe from binding to the nitrocellulose is soaking the nitrocellulose in a blocking solution that contains DNA, RNA, or protein. This blocking solution acts as a barrier, preventing the probe from binding to the nitrocellulose and allowing it to specifically bind to the target molecule.

Submit

16. Which formula predicts the number of PCR products that can be produced?

Explanation

The formula 2n predicts the number of PCR products that can be produced, where n is the number of cycles. This formula suggests that the number of PCR products doubles with each cycle. Therefore, if there are n cycles, the number of PCR products will be 2n.

Submit

17. Which of the following is true?

Explanation

NADH yields 3 ATP via oxidative phosphorylation pathway because it carries electrons from the citric acid cycle to the electron transport chain, where the electrons are passed along a series of protein complexes. This process generates a proton gradient, which drives the synthesis of ATP through ATP synthase. Each NADH molecule that enters the electron transport chain can generate enough energy to produce 3 ATP molecules.

Submit

18. Which of the following enzymes is used to replicated the DNA strands in PCR?

Explanation

Taq DNA polymerase is the correct answer because it is the enzyme commonly used in PCR (Polymerase Chain Reaction) to replicate DNA strands. Taq DNA polymerase is derived from the thermophilic bacterium Thermus aquaticus, which can withstand the high temperatures required for PCR. It has a high processivity and can efficiently amplify DNA by adding nucleotides to the growing DNA strand. Taq DNA polymerase is also heat-stable, allowing it to withstand the denaturation step of PCR where the DNA strands are separated. Therefore, Taq DNA polymerase is the enzyme of choice for DNA replication in PCR.

Submit

19. Increasing agarose/acrylamide concentration in your gel will:

Explanation

Increasing agarose/acrylamide concentration in the gel will allow for greater separation of lower molecular weight bands. This is because higher concentrations of agarose/acrylamide create a denser gel matrix, which slows down the migration of larger molecules. As a result, smaller molecules can move more easily through the gel, leading to better separation of lower molecular weight bands.

Submit

20. The correct sequence of events during cycling in a PCR is...

Explanation

During cycling in a PCR, the first step is denaturation, which involves heating the DNA to separate the double-stranded DNA into single strands. This is followed by annealing, where the temperature is lowered to allow the primers to bind to their complementary sequences on the single-stranded DNA. Finally, extension occurs, where the temperature is raised and the DNA polymerase adds nucleotides to the primers, synthesizing new DNA strands. Therefore, the correct sequence of events during cycling in a PCR is denature, anneal, and extend.

Submit

21. A) Glucose + phosphate --> Glucose 6-phosphate  DeltaG = +3.3 kcal/mol B) ATP ---> ADP + phosphate DeltaG = -7.3 kcal/mol What reaction is endergonic and enodothermic?

Explanation

The reaction in option A, Glucose + phosphate -> Glucose 6-phosphate, has a positive deltaG value of +3.3 kcal/mol. A positive deltaG indicates that the reaction is endergonic, meaning it requires energy input to proceed. Additionally, since the reaction requires energy input, it is also endothermic. Therefore, option A is the correct answer.

Submit

22. During replication, the continuous addition of bases occurs:

Explanation

During replication, the continuous addition of bases occurs in the 5' to 3' direction. This is because DNA polymerase can only add nucleotides to the 3' end of an existing DNA strand. The 5' to 3' direction refers to the orientation of the DNA molecule, where the 5' end has a phosphate group attached to the 5th carbon of the sugar molecule, and the 3' end has a hydroxyl group attached to the 3rd carbon. Therefore, new nucleotides are added to the growing DNA strand in the 5' to 3' direction, resulting in a continuous replication process.

Submit

23. Which of the following statements is false?

Explanation

The statement "The reaction curve displaying the kinetics of allosteric enzymes are hyperbolic" is false. The kinetics of allosteric enzymes are not always displayed by a hyperbolic curve. Allosteric enzymes can exhibit sigmoidal kinetics, where the initial reaction rate is slow and then increases rapidly before reaching a maximum. This is due to the cooperative binding of substrate molecules to the enzyme's active sites.

Submit

24. The process of transferring electrophoreses RNA out of a gel and onto a special nylon membrane is referred to as:

Explanation

Northern blotting is the process of transferring electrophoresed RNA out of a gel and onto a special nylon membrane. This technique allows for the detection and analysis of specific RNA molecules, such as mRNA, by using complementary DNA or RNA probes. It is commonly used in molecular biology research to study gene expression and identify RNA transcripts. Southern blotting, on the other hand, is used for the detection of specific DNA sequences, while PCR is a method for amplifying DNA. Western blotting is used to detect specific proteins, and Eastern blotting is not a recognized technique.

Submit

25. What term best describes the products proceeds when DNA is digested by restriction endonucleases?

Explanation

Restriction fragment length polymorphisms (RFLPs) is the best term to describe the products proceeds when DNA is digested by restriction endonucleases. RFLPs refer to the variations in the lengths of DNA fragments that are produced when a specific DNA sequence is cut by restriction enzymes. These variations can be used to analyze genetic differences and identify individuals or species. Therefore, RFLPs accurately describe the products generated by digestion with restriction endonucleases.

Submit

26. RT-PCR is the monitoring of the accumulation of amplified amplicons as they are being generated in the PCR reaction. The essential reagent required is?

Explanation

The correct answer is a single-stranded DNA probe that binds between the two primers, which is labeled with a fluorophore and a fluorescent quencher. This probe is essential in RT-PCR because it allows for the monitoring of the accumulation of amplified amplicons. The fluorophore emits light when excited, while the quencher suppresses the fluorescence. When the probe binds to the target DNA sequence during the PCR reaction, the fluorophore and quencher are brought into close proximity, resulting in fluorescence suppression. As the amplicons are generated, the probe is cleaved, separating the fluorophore from the quencher and allowing fluorescence to be detected, indicating amplification.

Submit

27. In which of the following categories is ATCH classified?

Explanation

ATCH is classified under the category of Protein/polypeptide.

Submit

28. Because of the biochemical properties of steroid hormones, the majority of these hormones at physiological concentrations...

Explanation

Steroid hormones have a high affinity for carrier proteins in the circulation due to their biochemical properties. This binding allows for the hormones to be transported through the bloodstream, protecting them from degradation and increasing their solubility. It also helps to regulate the availability and activity of the hormones in target tissues. Therefore, the majority of steroid hormones at physiological concentrations are bound with a high affinity to carrier proteins in the circulation.

Submit

29. Which of the following regulatory mechanisms is best described as the covalent bonding of phosphate to a multi-enzyme cluster that results in activation or inhibition of the rate limiting rep in a metabolic pathway?

Explanation

Enzyme modulation is the best described regulatory mechanism in this scenario. It involves the covalent bonding of phosphate to a multi-enzyme cluster, which leads to the activation or inhibition of the rate limiting step in a metabolic pathway. This process can regulate the activity of the enzymes involved and control the overall flux of the pathway. Competitive inhibition and non-competitive inhibition do not involve covalent bonding of phosphate, and enzyme activity is a more general term that does not specifically describe the covalent bonding of phosphate to a multi-enzyme cluster.

Submit

30. The thyroid gland produces all of the following hormone except:

Explanation

TSH stands for thyroid-stimulating hormone, which is not produced by the thyroid gland itself. Instead, it is produced by the pituitary gland and acts on the thyroid gland to stimulate the production of thyroxine and triiodothyronine. Therefore, TSH is not produced by the thyroid gland, making it the correct answer.

Submit

31. Which double-stranded molecule has the highest melting temperature?

Explanation

The melting temperature of a double-stranded molecule is determined by the stability of the hydrogen bonds between the two strands. C-G base pairs form three hydrogen bonds, while A-T base pairs form only two. Therefore, a molecule with repeating sequences of C-G-C codons will have more stable hydrogen bonds and a higher melting temperature compared to the other options.

Submit

32. If RNA is to be used in a PCR amplification procedure, what is the initial step that must be performed?

Explanation

The correct answer is that a reverse transcription procedure must be performed to form cDNA. In a PCR amplification procedure, RNA cannot be directly used as a template because the enzymes used in PCR, such as DNA polymerase, cannot synthesize strands to anneal to RNA. Therefore, the RNA is first converted into complementary DNA (cDNA) through reverse transcription. This process involves using the enzyme reverse transcriptase to synthesize a complementary DNA strand from the RNA template. This cDNA can then be used as a template for PCR amplification.

Submit

33. The required reagents for PCR are:

Explanation

The correct answer is "Template DNA, two oligonucleotide primer, nucleotides in excess, Taq polymerase." PCR (Polymerase Chain Reaction) is a technique used to amplify a specific DNA sequence. The template DNA serves as the starting material, the two oligonucleotide primers bind to the target sequence, the nucleotides provide the building blocks for DNA synthesis, and Taq polymerase is the enzyme responsible for DNA replication.

Submit

34. The net summary reaction written below represents: Acetyl CoA + 3NAD+ + FAD + GDP + pi + 2H2O ---> 2CO2 + 3NADH + FADH2 + GTP + 2H + CoA

Explanation

The net summary reaction represents the Citric acid cycle, which is a series of chemical reactions that occur in the mitochondria of cells. This cycle plays a crucial role in the metabolism of carbohydrates, fats, and proteins, generating energy-rich molecules such as NADH, FADH2, and GTP. The reaction involves the breakdown of Acetyl CoA and the production of carbon dioxide, NADH, FADH2, GTP, and CoA. This process is catabolic, meaning it involves the breakdown of molecules to release energy. Therefore, the correct answer is "Citric acid cycle" and "Catabolic".

Submit

35. A gel loading standard is used to:

Explanation

A gel loading standard is used to mark the locations of known molecular weights. This is important in gel electrophoresis, as it allows researchers to compare the migration of their samples to the migration of the standard. By knowing the molecular weights of the standard bands, they can estimate the molecular weights of their samples based on their migration distances. This helps in determining the size or weight of the molecules being analyzed.

Submit

36. The illustration below highlightes in bold from the DNA section that needs to be amplified by the PCR. 5'      GCAATTCTGCAAGCTTAGCCGATGCTAGCCCAAGTAC     3' 3'      CGTTAAGACGTTCGAATCGGCTACGATCGGGTTCATG     5' Which of the following set of primers would you use for the PCR

Explanation

The correct answer is 3' GGGTT 5' and 5' CTTAG 3'. This is because the primers should be complementary to the target DNA sequence that needs to be amplified. In this case, the target DNA sequence is highlighted in bold in the given illustration. By comparing the target DNA sequence with the options provided, it can be seen that the primer sequences in the correct answer are complementary to the target DNA sequence, allowing for efficient amplification of the desired DNA fragment during PCR.

Submit

37. Steroid hormones exert their action by:

Explanation

Steroid hormones are lipid-soluble molecules that can easily cross the plasma membrane. Once inside the cell, they bind to specific receptors located in the cytoplasm. This hormone-receptor complex then enters the nucleus and binds to specific DNA sequences, either activating or inhibiting the expression of target genes. This process allows steroid hormones to directly regulate gene expression and initiate cellular responses. Therefore, the correct answer is that steroid hormones cross the plasma membrane and bind to cytoplasmic receptors.

Submit

38. Identify the correct step sequences in blotting techniques.

Explanation

The correct step sequence in blotting techniques is as follows: Gel electrophoresis, transfer to solid support, blocking, preparing the probe, hybridization, washing, and detection of probe. This sequence ensures that the gel is transferred onto a solid support, any nonspecific binding sites are blocked, the probe is prepared and hybridized to the target molecules, any unbound probe is washed away, and the probe is detected to visualize the target molecules.

Submit

39. An inhibitor of an allosteric enzyme would change the reaction curve #3 in which direction? ( Refer to test)

Explanation

An inhibitor of an allosteric enzyme would change the reaction curve #3 to the right, increasing Km. This means that the inhibitor would decrease the affinity of the enzyme for its substrate, resulting in a higher concentration of substrate required to reach half of the maximum reaction rate. As a result, the enzyme would be less efficient in converting substrate to product, leading to an increase in Km.

Submit

40. If a patient was given TRH, which of the following test results would be expected normal in a healthy individual?

Explanation

When a patient is given TRH (thyrotropin-releasing hormone), it stimulates the release of thyroid-stimulating hormone (TSH) from the pituitary gland. TSH then acts on the thyroid gland to promote the production and release of thyroid hormones, including thyroxine (T4). In a healthy individual, the administration of TRH would lead to an increase in both FT4 (free thyroxine) and TSH levels. This is because the increased TSH would stimulate the thyroid gland to produce more T4, resulting in increased FT4 levels. Therefore, the expected normal test results in a healthy individual after receiving TRH would be increased FT4 and increased TSH.

Submit

41. How can PCR be applied to the detection of human immunodeficiency and other RNA viruses?

Explanation

PCR (Polymerase Chain Reaction) is a technique used to amplify specific DNA sequences. However, in the case of RNA viruses like human immunodeficiency virus (HIV), which have RNA as their genetic material, an additional step is required. The RNA must first be converted into complementary DNA (cDNA) using an enzyme called reverse transcriptase. This cDNA can then be amplified using PCR. Therefore, in order to apply PCR to the detection of RNA viruses, heat-stable reverse transcriptase enzymes need to be added to the PCR master mix to convert the RNA into cDNA before the amplification step.

Submit

42. Match the following hormones with the endocrine gland responsible for its synthesis.

Submit

43. Match the following pathways with the starting substrate and end product listed below.

Submit
×
Saved
Thank you for your feedback!
View My Results
Cancel
  • All
    All (43)
  • Unanswered
    Unanswered ()
  • Answered
    Answered ()
Increasing agarose/acrylamide concentration in your gel will:
Running a gel for less time than required could:
Chemical signalling affecting neighbouring cells is defined as:
The correct notation for the reduced form of nicotinamide adenine...
Identify the unique property/characteristic of allosteric enzymes in...
Which of the following statements most accurately reflects the action...
A) Glucose + phosphate --> Glucose 6-phosphate  DeltaG = +3.3...
THe process of transferring digested electrophoreses protein out of a...
Protein hormones bind to receptors located...
A) Glucose + phosphate --> Glucose 6-phosphate  DeltaG = +3.3...
A gel loading control is used to:
When transferring sample from a gel to a nitrocellulose membrane....
Catabolic processes...
Statements:...
In blotting techniques, what procedure is used to prevent the probe...
Which formula predicts the number of PCR products that can be...
Which of the following is true?
Which of the following enzymes is used to replicated the DNA strands...
Increasing agarose/acrylamide concentration in your gel will:
The correct sequence of events during cycling in a PCR is...
A) Glucose + phosphate --> Glucose 6-phosphate  DeltaG = +3.3...
During replication, the continuous addition of bases occurs:
Which of the following statements is false?
The process of transferring electrophoreses RNA out of a gel and onto...
What term best describes the products proceeds when DNA is digested by...
RT-PCR is the monitoring of the accumulation of amplified amplicons as...
In which of the following categories is ATCH classified?
Because of the biochemical properties of steroid hormones, the...
Which of the following regulatory mechanisms is best described as the...
The thyroid gland produces all of the following hormone except:
Which double-stranded molecule has the highest melting temperature?
If RNA is to be used in a PCR amplification procedure, what is the...
The required reagents for PCR are:
The net summary reaction written below represents:...
A gel loading standard is used to:
The illustration below highlightes in bold from the DNA section that...
Steroid hormones exert their action by:
Identify the correct step sequences in blotting techniques.
An inhibitor of an allosteric enzyme would change the reaction curve...
If a patient was given TRH, which of the following test results would...
How can PCR be applied to the detection of human immunodeficiency and...
Match the following hormones with the endocrine gland responsible for...
Match the following pathways with the starting substrate and end...
play-Mute sad happy unanswered_answer up-hover down-hover success oval cancel Check box square blue
Alert!