Chemistry Test 2012 #4

43 Questions | Total Attempts: 37

SettingsSettingsSettings
Please wait...
Chemistry Quizzes & Trivia

Questions and Answers
  • 1. 
    The correct notation for the reduced form of nicotinamide adenine dinucleotide is:
    • A. 

      NAD+

    • B. 

      NAD

    • C. 

      NADH

    • D. 

      NADH2

  • 2. 
    Catabolic processes...
    • A. 

      Are synthetic

    • B. 

      Produce ADP

    • C. 

      Produce NAD

    • D. 

      Produce ATP

  • 3. 
    Which of the following statements is false?
    • A. 

      Synthetic and degradative pathways are distinct and separate pathways

    • B. 

      Each pathway has one or more rate-limiting reactions

    • C. 

      The rate-limiting reactions in a metabolic pathway are catalyzed by allosteric enzymes

    • D. 

      The reaction curve displaying the kinetics of allosteric enzymes are hyperbolic

  • 4. 
    Which of the following is true?
    • A. 

      NAD yields 3 ATP via oxidative phosphorylation pathway

    • B. 

      FAD yields 2 ATP via oxidative phosphorylation pathway

    • C. 

      NADH yields 3 ATP via oxidative phosphorylation pathway

    • D. 

      FADH yields 2 ATP via oxidative phosphorylation pathway

  • 5. 
    The net summary reaction written below represents: Acetyl CoA + 3NAD+ + FAD + GDP + pi + 2H2O ---> 2CO2 + 3NADH + FADH2 + GTP + 2H + CoA
    • A. 

      Fatty acid cycle

    • B. 

      Citric acid cycle

    • C. 

      Catabolic

    • D. 

      Anabolic

    • E. 

      Only b and c

    • F. 

      Only a and d

  • 6. 
    An inhibitor of an allosteric enzyme would change the reaction curve #3 in which direction? ( Refer to test)
    • A. 

      To the left decreasing Km

    • B. 

      To the right decreasing Km

    • C. 

      To the left increasing Km

    • D. 

      To the right increasing Km

  • 7. 
    Which of the following regulatory mechanisms is best described as the covalent bonding of phosphate to a multi-enzyme cluster that results in activation or inhibition of the rate limiting rep in a metabolic pathway?
    • A. 

      Competitive inhibition

    • B. 

      Enzyme modulation

    • C. 

      Non-competitive inhibition

    • D. 

      Enzyme activity

  • 8. 
    Statements: 1) High-energy phosphate compounds contain one or more strained bonds that release above-average amounts of energy when broken. 2) In the electron Transport Chain, NADH is oxidized to NAD+ 3) The "fuel" for the citric acid cycle is acetyl CoA
    • A. 

      All three statements are true

    • B. 

      Two of these statements are true

    • C. 

      Two of these statements are false

    • D. 

      One of these statements are true

    • E. 

      None of these statements are true

  • 9. 
    Identify the unique property/characteristic of allosteric enzymes in comparison to other enzymes.
    • A. 

      Globular proteins

    • B. 

      Affect rate of reactions

    • C. 

      Have a quaternary structure

    • D. 

      Activity dependant on pH

  • 10. 
    A) Glucose + phosphate --> Glucose 6-phosphate  DeltaG = +3.3 kcal/mol B) ATP ---> ADP + phosphate DeltaG = -7.3 kcal/mol What reaction is endergonic and enodothermic?
    • A. 

      A

    • B. 

      B

  • 11. 
    A) Glucose + phosphate --> Glucose 6-phosphate  DeltaG = +3.3 kcal/mol B) ATP ---> ADP + phosphate DeltaG = -7.3 kcal/mol Which of the above reactions is spontaneous and exothermic?
    • A. 

      A

    • B. 

      B

  • 12. 
    A) Glucose + phosphate --> Glucose 6-phosphate  DeltaG = +3.3 kcal/mol B) ATP ---> ADP + phosphate DeltaG = -7.3 kcal/mol What is the net DG (kcal/mol) in the coupling reactions?
    • A. 

      + 10.6

    • B. 

      - 4

    • C. 

      - 7.3

    • D. 

      + 3.3

  • 13. 
    The process of transferring electrophoreses RNA out of a gel and onto a special nylon membrane is referred to as:
    • A. 

      Southern blotting

    • B. 

      PCR

    • C. 

      Northern blotting

    • D. 

      Western blotting

    • E. 

      Eastern blotting

    • F. 

      Transferring unimportant material that doesn't matter

  • 14. 
    Which of the following statements most accurately reflects the action of Bacterial restriction enzyme?
    • A. 

      Cut a strand of DNA at specific locations.

    • B. 

      Cut both strands of DNA to yield a set of double stranded DNA with single stranded sticky ends.

    • C. 

      Cut both strands of DNA to yield two fragments of single stranded DNA.

    • D. 

      Cut RNA strands at specific locations

  • 15. 
    Which double-stranded molecule has the highest melting temperature?
    • A. 

      An oligonucleotide with repeating sequence of A-A-A at the 5' end

    • B. 

      A molecule of 5,000 base pairs with a high number of A-T base pairs

    • C. 

      An oligonucleotide with repeating sequences of C-G-C codons

    • D. 

      A DNA polymer of 100,000 base pairs

  • 16. 
    In blotting techniques, what procedure is used to prevent the probe from binding to the nitrocellulose?
    • A. 

      Nitrocellulose is soaked in blocking solution which contains DNA, RNA or protein

    • B. 

      None required since probe binds only to target molecule

    • C. 

      Electrophoresis of target molecule prior to application of probe

    • D. 

      Antibody attached to probe identifies target molecule

  • 17. 
    The correct sequence of events during cycling in a PCR is...
    • A. 

      Anneal, extend and denature

    • B. 

      Denature, anneal and extend

    • C. 

      Extend, anneal and denature

    • D. 

      Extend, denature and anneal

  • 18. 
    If RNA is to be used in a PCR amplification procedure, what is the initial step that must be performed?
    • A. 

      The RNA must be denatured to form single strands for annealing to primers

    • B. 

      RNA shoulds never be used in a PCR reaction because thermostable enzymes cannot synthesize strands to anneal it

    • C. 

      A reverse transcription procedure must be performs to form cDNA

    • D. 

      RNA must first be treated with RNases to remove interfering substances from the target

  • 19. 
    THe process of transferring digested electrophoreses protein out of a gel and onto a nylon membrane is referred to as:
    • A. 

      Southern blotting

    • B. 

      Northern blotting

    • C. 

      Western blotting

    • D. 

      Eastern blotting

    • E. 

      Hybridization

  • 20. 
    Identify the correct step sequences in blotting techniques.
    • A. 

      Gel electrophoresis, blocking, transfer to solid support, preparing the probe, hybridization, washing and detection of probe.

    • B. 

      Gel electrophoresis, transfer to solid support, washing, blocking, preparing the probe, hybridization and detection fo probe.

    • C. 

      Gel electrophoresis, transfer to solid support, blocking, preparing the probe, blocking, hybridization, washing, detection of probe.

    • D. 

      Gel electrophoresis, transfer to solid support, blocking, preparing the probe, hybridization, washing, detection of probe.

  • 21. 
    Increasing agarose/acrylamide concentration in your gel will:
    • A. 

      Allow for greater separation of lower molecular weight bands

    • B. 

      Allow for greater separation of higher molecular weight bands

    • C. 

      Cause all bands to migrate faster, reducing your run time

    • D. 

      Cause all bands to migrate slower, increasing your run time

  • 22. 
    A gel loading standard is used to:
    • A. 

      Increase the electrical charge of your sample

    • B. 

      Mark the locations of known molecular weights

    • C. 

      Determine if samples were loaded evenly across the wells

    • D. 

      Denature your sample

  • 23. 
    A gel loading control is used to:
    • A. 

      Increase the electrical charge of your sample

    • B. 

      Mark the locations of known molecular weights

    • C. 

      Determine if samples were loaded evenly across wells

    • D. 

      Denature your sample

  • 24. 
    Running a gel for less time than required could:
    • A. 

      Cause your sample to renature

    • B. 

      Cause your sample to run off the edge of the gel

    • C. 

      Affect blocking stage

    • D. 

      Decrease the amount of separation between bands

  • 25. 
    The illustration below highlightes in bold from the DNA section that needs to be amplified by the PCR. 5'      GCAATTCTGCAAGCTTAGCCGATGCTAGCCCAAGTAC     3' 3'      CGTTAAGACGTTCGAATCGGCTACGATCGGGTTCATG     5' Which of the following set of primers would you use for the PCR
    • A. 

      3' GGUU 5' and 5' CUUAG 3'

    • B. 

      3' GGGTT 5' and 5' CTTAG 3'

    • C. 

      5' GGGTT 3' and 3' CTTAG 5'

    • D. 

      3' GGGTT 5' and 3' CTTAG 5'

Back to Top Back to top