Bio 1 - Unit 6b - Central Dogma

27 Questions

Settings
Please wait...
Bio 1 - Unit 6b - Central Dogma

Questions and Answers
  • 1. 
    Which of the following is a pair of complementary bases?
    • A. 

      Cytosine and cytosine

    • B. 

      Thymine and adenine

    • C. 

      Adenine and guanine

    • D. 

      Thymine and ctyosine

  • 2. 
    In a DNA molecule, which molecules make up the sides of the double helix?
    • A. 

      Single nucleotides

    • B. 

      Pairs of nucleotides

    • C. 

      Joined sugars and phosphates

    • D. 

      Joined nitrogenous bases and phosphates

  • 3. 
    If one strand of a DNA molecule reads TATCGAT, what does the complementary strand of DNA read?
    • A. 

      GCGATCG

    • B. 

      ATAGCTA

    • C. 

      CGCATCG

    • D. 

      ATAGCAT

  • 4. 
    Which of the following statements about DNA and RNA is true?
    • A. 

      RNA is arranged in a double helix.

    • B. 

      The kinds of sugar in the nucleotides of DNA and RNA differ.

    • C. 

      DNA contains nitrogenous bases and phosphates, while RNA does not.

    • D. 

      DNA contains uracil, while RNA contains thymine.

  • 5. 
    Which DNA sequence produced an mRNA strand with the sequence AGUACA?
    • A. 

      UCAUGU

    • B. 

      TCATGT

    • C. 

      GUACAG

    • D. 

      CAGTAC

  • 6. 
    Transcription creates an mRNA molecule using DNA as a template. Where does this occur?
    • A. 

      Outside the cell

    • B. 

      In the cytoplasm

    • C. 

      In the nucleus

    • D. 

      In the ribosomes

  • 7. 
    The sequence of a strand of mRNA is GCAUUGUAA. If the sequence includes a stop codon, how many amino acids does this code for? (STOP is not an amino acid)
    • A. 

      2

    • B. 

      3

    • C. 

      6

    • D. 

      9

  • 8. 
    What process is illustrated in the diagram?
    • A. 

      Replication

    • B. 

      Transcription

    • C. 

      Translation

    • D. 

      Mutation

  • 9. 
    Ribosomes are made of ___.
    • A. 

      RRNA and two protein subunits

    • B. 

      TRNA and mRNA

    • C. 

      RRNA and mRNA

    • D. 

      Protein and tRNA

  • 10. 
    Watson and Crick, with the help of Rosalind Franklin, were the first to suggest that DNA is ___.
    • A. 

      A short molecule

    • B. 

      A protein molecule

    • C. 

      The shape of a double helix

    • D. 

      The genetic material

  • 11. 
    Messenger RNA (mRNA)  is formed in the process of ___.
    • A. 

      Transcription

    • B. 

      Translation

    • C. 

      Replication

    • D. 

      Mutation

  • 12. 
    The process by which a DNA molecule is copied is ___.
    • A. 

      Transcription

    • B. 

      Translation

    • C. 

      Replication

    • D. 

      Mutation

  • 13. 
    Each set of three nucleotides on mRNA coding for an amino acid is referred to as a(n) ___.
    • A. 

      Codon

    • B. 

      Anticodon

    • C. 

      Ribosome

    • D. 

      Base pair

  • 14. 
    The nucleotide triplet on tRNA that complements a codon is called a(n) ___.
    • A. 

      Codon

    • B. 

      Anticodon

    • C. 

      Ribosome

    • D. 

      Base pair

  • 15. 
    Adenine is to thymine as guanine is to ___.
    • A. 

      Uracil

    • B. 

      Cytosine

    • C. 

      Adenine

    • D. 

      Thymine

  • 16. 
    DNA is to RNA as double strand is to ___.
    • A. 

      Single strand

    • B. 

      Ribose

    • C. 

      Triple strand

    • D. 

      Double helix

  • 17. 
    Transcription is to mRNA as translation is to ___.
    • A. 

      Protein

    • B. 

      Codon

    • C. 

      TRNA

    • D. 

      DNA

  • 18. 
    What is the molecule labeled A?
    • A. 

      Nucleotide

    • B. 

      Phosphate group

    • C. 

      Ribose sugar

    • D. 

      Nitrogen base

  • 19. 
    What is the component labeled B?
    • A. 

      Nucleotide

    • B. 

      Phosphate group

    • C. 

      Ribose sugar

    • D. 

      Nitrogen base

  • 20. 
    If this molecule is found in DNA, then structure C would be called ___.
    • A. 

      Ribose sugar

    • B. 

      Phosphate group

    • C. 

      Deoxyribose sugar

    • D. 

      Nitrogen base

  • 21. 
    If this molecule is found in RNA, then structure C would be called ___.
    • A. 

      Ribose sugar

    • B. 

      Phosphate group

    • C. 

      Deoxyribose sugar

    • D. 

      Nitrogen base

  • 22. 
    The structure labeled D is a(n) ___.
    • A. 

      Ribose sugar

    • B. 

      Phosphate group

    • C. 

      Deoxyribose sugar

    • D. 

      Nitrogen base

  • 23. 
    The number of rings in the nitrogen base indicates that this molecule is classified as a(n) ___.
    • A. 

      Pyrimidine

    • B. 

      Alanine compound

    • C. 

      Purine

    • D. 

      Tangerine

  • 24. 
    The number of rings in the nitrogen base indicates that this molecule is classified as a(n) ___.
    • A. 

      Pyrimidine

    • B. 

      Alanine compound

    • C. 

      Purine

    • D. 

      Tangerine

  • 25. 
    Translate the following mRNA code. What is the amino acid sequence? GGUCGAUGGUGGCCCACCAGAGAUGAGUUAA
    • A. 

      Met - Val - Ala - His - Gln - Arg

    • B. 

      Gly - Arg - Trp - Trp - Pro - Thr - Arg - Met - Ser

    • C. 

      Met - Pro - Ala - His - Trp - Trp - Ser

    • D. 

      Gly - Arg - Trp - Pro - Met - Val - Arg

  • 26. 
    The nucleotide that is found in RNA but not DNA is ___.
    • A. 

      Uracil

    • B. 

      Cytosine

    • C. 

      Adenine

    • D. 

      Thymine

  • 27. 
    The nucleotide that is found in DNA but not RNA is ___.
    • A. 

      Uracil

    • B. 

      Cytosine

    • C. 

      Adenine

    • D. 

      Thymine