Unit Two Chapter One 3rd SEC. Quiz 2

Reviewed by Editorial Team
The ProProfs editorial team is comprised of experienced subject matter experts. They've collectively created over 10,000 quizzes and lessons, serving over 100 million users. Our team includes in-house content moderators and subject matter experts, as well as a global network of rigorously trained contributors. All adhere to our comprehensive editorial guidelines, ensuring the delivery of high-quality content.
Learn about Our Editorial Process
| By Samy
S
Samy
Community Contributor
Quizzes Created: 13 | Total Attempts: 3,339
| Attempts: 182
Quiz Flashcard
SettingsSettings
Please wait...
  • 1/63 Questions

    DNA does not appear in free linear strands; it is highly condensed and wrapped around nuclear proteins and packed up as tightly as possible to form a condensed chromatin which is held by .....

    • Structural non histones
    • Structural histones
    • Regulatory non histones
    • Nucleosomes
Please wait...
About This Quiz

This quiz tests knowledge on DNA structure, mutations like insertion, deletion, inversion, and substitution, and their impacts on genetic sequences.

Unit Two Chapter One 3rd SEC. Quiz 2 - Quiz

Quiz Preview

  • 2. 

    Which type of mutation happens to the following sequence of nucleotides? Original: ATC CAT Mutation: ATC GCAT

    • Deletion.

    • Insertion.

    • Inversion of a part 180o.

    • Crossing over between two non-homologous chromosomes.

    Correct Answer
    A. Insertion.
    Explanation
    The given mutation involves the addition of the nucleotide sequence "GCAT" into the original sequence "ATC CAT". This results in a longer sequence compared to the original, indicating an insertion mutation.

    Rate this question:

  • 3. 
    The following figure is the structure of the chromosome in Eukaryotes. What are (A), (B), (C) and (D) respectively? - ProProfs

    The following figure is the structure of the chromosome in Eukaryotes. What are (A), (B), (C) and (D) respectively?

    • Coiled nucleosomes – condensed chromatin – nucleosomes – histones

    • Coiled nucleosomes – condensed chromatin – histones – nucleosomes

    • Condensed chromatin – coiled nucleosomes – histones – nucleosomes

    • Condensed chromatin – coiled nucleosomes – nucleosomes – histones

    Correct Answer
    A. Condensed chromatin – coiled nucleosomes – nucleosomes – histones
    Explanation
    The correct answer is "Condensed chromatin – coiled nucleosomes – nucleosomes – histones." In eukaryotes, DNA is tightly packaged into structures called nucleosomes, which consist of DNA wrapped around histone proteins. Nucleosomes then coil further to form condensed chromatin, which is the highly compacted form of DNA. Therefore, (A) condensed chromatin comes first, followed by (B) coiled nucleosomes, (C) nucleosomes, and (D) histones.

    Rate this question:

  • 4. 

    The small circular DNA in bacteria is called …..

    • Double helix

    • Plasmid

    • Chromatin

    • Sugar-phosphate backbone

    Correct Answer
    A. Plasmid
    Explanation
    Plasmids are small circular DNA molecules found in bacteria. They are separate from the bacterial chromosome and can replicate independently. Plasmids often carry genes that provide advantages to the bacteria, such as antibiotic resistance or the ability to produce certain proteins. They can also transfer between bacteria, allowing for the spread of these advantageous genes. The other options, double helix, chromatin, and sugar-phosphate backbone, are all components or structures related to DNA, but they do not specifically refer to the small circular DNA found in bacteria.

    Rate this question:

  • 5. 

    Triploidy in humans was found to cause …….

    • Congenital deformities

    • Sterility

    • Miscarriage

    • Death at puberty

    Correct Answer
    A. Miscarriage
    Explanation
    Triploidy in humans refers to the condition where an individual has three sets of chromosomes instead of the usual two. This chromosomal abnormality often leads to severe developmental issues and is commonly associated with miscarriages. The presence of an extra set of chromosomes disrupts the normal development of the fetus, resulting in miscarriage. Therefore, triploidy in humans is known to cause miscarriages rather than congenital deformities, sterility, or death at puberty.

    Rate this question:

  • 6. 

    The mutation that leads to the change in the arrangement of the nitrogenous bases of the DNA molecule is called ………

    • Chromosomal number mutation

    • Gene mutation

    • Chromosomal structure mutation

    • All the previous

    Correct Answer
    A. Gene mutation
    Explanation
    Gene mutation refers to the mutation that leads to a change in the arrangement of the nitrogenous bases of the DNA molecule. This type of mutation can occur at the level of a single gene and can result in the production of a different protein or the absence of a protein altogether. It can be caused by various factors such as errors during DNA replication, exposure to certain chemicals or radiation, or spontaneous changes in the DNA sequence. Chromosomal number mutation refers to changes in the number of chromosomes, while chromosomal structure mutation refers to changes in the structure of chromosomes.

    Rate this question:

  • 7. 

    The structural non-histones play a role in ……

    • Binding with the phosphate groups in DNA molecule

    • Determining the DNA code that will be used in making RNA

    • Regulating the spatial organization of the DNA

    • Shortening the DNA molecule ten folds

    Correct Answer
    A. Regulating the spatial organization of the DNA
    Explanation
    The structural non-histones play a role in regulating the spatial organization of the DNA. This means that they help in organizing and arranging the DNA molecule in the nucleus of the cell. They ensure that the DNA is properly folded and packaged, allowing for efficient gene expression and DNA replication. This organization is crucial for the proper functioning of the cell and the maintenance of its genetic information.

    Rate this question:

  • 8. 

    Which of the following is not a common property of arginine and lysine amino acids?

    • They have positive (R) groups

    • They share in building up histone molecules

    • They have the same (R) groups

    • They are basic amino acids

    Correct Answer
    A. They have the same (R) groups
    Explanation
    Arginine and lysine amino acids have positive (R) groups and are basic amino acids. They also share in building up histone molecules. However, they do not have the same (R) groups, as the (R) group of arginine contains a guanidino group while the (R) group of lysine contains an amino group.

    Rate this question:

  • 9. 
    The diagram provided shows a basic outline of how chromosomes are formed in eukaryotes. Which letter on the diagram indicates the chromatin? - ProProfs

    The diagram provided shows a basic outline of how chromosomes are formed in eukaryotes. Which letter on the diagram indicates the chromatin?

    • V

    • Z

    • X

    • Y

    Correct Answer
    A. X
    Explanation
    The letter X on the diagram indicates the chromatin. Chromatin is the material that makes up chromosomes, consisting of DNA and proteins. It is in a less condensed form compared to chromosomes and is found in the nucleus of a cell during interphase.

    Rate this question:

  • 10. 
    The diagram provided shows a simplified outline of the different types of gene mutations that can occur in a strand of DNA. Which diagram, demonstrates a substitution mutation? - ProProfs

    The diagram provided shows a simplified outline of the different types of gene mutations that can occur in a strand of DNA. Which diagram, demonstrates a substitution mutation?

    • 1

    • 2

    • 3

    • None of them

    Correct Answer
    A. 2
    Explanation
    Diagram 2 shows a substitution mutation because it depicts a single nucleotide being replaced by another nucleotide. In this type of mutation, one base pair is substituted for another, resulting in a change in the DNA sequence. This can lead to the production of a different protein or a non-functional protein. Diagram 1 and 3 do not show substitution mutations as they represent other types of mutations such as insertion or deletion of nucleotides. Therefore, the correct diagram that demonstrates a substitution mutation is diagram 2.

    Rate this question:

  • 11. 

    Inversion mutation results in _______.

    • The formation of many copies of a specific region of the affected chromosome

    • The breakage and movement of chromosome fragments

    • More than one copy of each gene on a chromosome

    • A genetic change that involves the loss or gain of entire chromosomes

    • Segments of DNA being released from a chromosome then re-inserted in the opposite orientation

    Correct Answer
    A. Segments of DNA being released from a chromosome then re-inserted in the opposite orientation
    Explanation
    Inversion mutation refers to a genetic change where segments of DNA are released from a chromosome and then re-inserted in the opposite orientation. This results in the rearrangement of genetic material within a chromosome.

    Rate this question:

  • 12. 

    All of the following are from the characteristics of Eukaryotic DNA except ……….

    • Linked with histones

    • Linked with non-histones proteins

    • Double helix with its ends joined to each other

    • Must be packed about 100,000 times more tightly to fit into the nucleus

    Correct Answer
    A. Double helix with its ends joined to each other
    Explanation
    Eukaryotic DNA is double helix in structure, but its ends are not joined to each other. Instead, they are free and can be replicated or transcribed independently. This is in contrast to prokaryotic DNA, where the ends are joined to form a circular structure. The other characteristics listed, such as being linked with histones or non-histones proteins and the need to be tightly packed to fit into the nucleus, are all true for eukaryotic DNA.

    Rate this question:

  • 13. 

    From the eukaryotes that contains plasmid …...

    • Bread mould

    • Yeast

    • Mushroom

    • Penicillium

    Correct Answer
    A. Yeast
    Explanation
    Yeast is a type of eukaryote that contains plasmid. Plasmids are small, circular DNA molecules that can be found in some eukaryotic cells, including certain types of yeast. Plasmids are separate from the cell's main genome and can replicate independently. Yeast is known for its ability to ferment sugars and produce alcohol, which is made possible by the presence of plasmids. Therefore, yeast is the correct answer in this case.

    Rate this question:

  • 14. 

    DNA is not organized in the form of chromosomes in ……..

    • Bacteria

    • Chloroplasts

    • Mitochondria

    • All the above

    Correct Answer
    A. All the above
    Explanation
    DNA is not organized in the form of chromosomes in bacteria, chloroplasts, and mitochondria. In bacteria, the DNA is usually present in a circular form called a plasmid, which is separate from the main chromosome. In chloroplasts and mitochondria, the DNA is also organized differently from the linear chromosomes found in the nucleus of eukaryotic cells. Instead, it is organized in circular or linear molecules, and the number of DNA molecules can vary within these organelles. Therefore, the correct answer is that DNA is not organized in the form of chromosomes in all of the above options.

    Rate this question:

  • 15. 

    DNA is wrapped around proteins and coiled into loops to form chromatin. At what point will chromatin condense to form visible chromosomes?

    • When cells are stimulated by chemical messengers

    • When cells become fertilized

    • As cells prepare for cell division

    • Shortly after cells have completed cell division

    • Immediately after chromatin has formed

    Correct Answer
    A. As cells prepare for cell division
    Explanation
    During cell division, chromatin undergoes a process called condensation, where it becomes tightly coiled and compacted. This condensation allows for easier separation and distribution of genetic material into daughter cells. Therefore, chromatin will condense to form visible chromosomes as cells prepare for cell division.

    Rate this question:

  • 16. 

    Choose the INCORRECT statement about mutation?

    • All mutations are spontaneous.

    • Major source of evolution.

    • Usually recessive.

    • Some mutations are reversible where the nucleotide is changed back to its original state.

    Correct Answer
    A. All mutations are spontaneous.
    Explanation
    The given statement "All mutations are spontaneous" is incorrect. Mutations can occur spontaneously, but they can also be induced by various factors such as exposure to radiation or chemicals. Therefore, not all mutations are spontaneous.

    Rate this question:

  • 17. 

    Which type of mutation happens to the following sequence of nucleotides? Original DNA: CAT GAT New DNA: CAT AT

    • Deletion

    • Substitution

    • Transition

    • Insertion

    Correct Answer
    A. Deletion
    Explanation
    The given sequence of nucleotides has undergone a deletion mutation. This is evident from the fact that in the original DNA sequence "CAT GAT", a nucleotide "G" has been deleted in the new DNA sequence "CAT AT". Deletion mutation refers to the removal of one or more nucleotides from the DNA sequence, leading to a change in the genetic code.

    Rate this question:

  • 18. 

    Which type of mutation happens to the following sequence of nucleotides? Original: ABCDEF Mutation: ACEFBD

    • Deletion

    • Substitution

    • Inversion (rearrangement)

    • Insertion

    Correct Answer
    A. Inversion (rearrangement)
    Explanation
    The original sequence "ABCDEF" has undergone an inversion mutation to become "ACEFBD". In an inversion mutation, a segment of the DNA sequence is reversed or flipped in orientation. In this case, the segment "CDEF" has been inverted to become "FEDC". This type of mutation can lead to changes in the function of genes and can have significant effects on the organism.

    Rate this question:

  • 19. 

    Which type of mutation happens to the following sequence of nucleotides? Gene: ABC   New Gene: BBC

    • Deletion

    • Inversion

    • Substitution

    • Insertion

    Correct Answer
    A. Substitution
    Explanation
    The given gene sequence "ABC" has undergone a mutation where the nucleotide "A" has been replaced by "B", resulting in the new gene sequence "BBC". This type of mutation, where one nucleotide is substituted for another, is known as a substitution mutation.

    Rate this question:

  • 20. 

    Colchicine is a chemical substance that is often used to induce tetraploidy in plants producing bigger fruits. Which of the following can be the action of colchicine in inducing polyploidy?

    • The non-separation of the chromatids after centromeric divison.

    • Prevents the spindle fibers formation during cell division.

    • Failure of membrane formation between the two daughter cells.

    • Any of the previous.

    Correct Answer
    A. Any of the previous.
    Explanation
    Colchicine can induce polyploidy in plants by interfering with various stages of cell division. It can prevent the separation of chromatids after centromeric division, inhibit the formation of spindle fibers during cell division, and cause failure of membrane formation between daughter cells. Therefore, any of these actions can contribute to the induction of polyploidy by colchicine.

    Rate this question:

  • 21. 

    Which of the following determines whether or not the DNA sequence is a code for making ligase enzymes?

    • Regulatory proteins

    • Structural histones

    • Structural non-histones

    • Chromatin

    Correct Answer
    A. Regulatory proteins
    Explanation
    Regulatory proteins determine whether or not the DNA sequence is a code for making ligase enzymes. These proteins play a crucial role in gene expression by binding to specific DNA sequences and controlling the transcription and translation processes. In this case, regulatory proteins would bind to the DNA sequence responsible for coding the ligase enzymes, thereby determining whether or not they are produced. Structural histones, structural non-histones, and chromatin are not directly involved in determining the coding potential of a DNA sequence.

    Rate this question:

  • 22. 
    Which type of mutation is the following figure? - ProProfs

    Which type of mutation is the following figure?

    • Substitution

    • Insertion

    • Inversion of a part 180o.

    • Crossing over between two non-homologous chromosomes.

    Correct Answer
    A. Inversion of a part 180o.
    Explanation
    The given answer, "Inversion of a part 180o," is the correct explanation for the type of mutation depicted in the figure. Inversion refers to a mutation where a segment of DNA is reversed within the chromosome. In this case, the figure shows a part of the chromosome being flipped 180 degrees, indicating an inversion mutation.

    Rate this question:

  • 23. 

    Organelles in Eukaryotes that carry DNA molecules ……

    • Mitochondria and plastids

    • Mitochondria and ribosomes

    • Ribosomes and lysosomes

    • Plastids and lysosomes

    Correct Answer
    A. Mitochondria and plastids
    Explanation
    Mitochondria and plastids are organelles in eukaryotes that carry DNA molecules. Mitochondria are responsible for producing energy in the form of ATP through cellular respiration and have their own DNA. Plastids, such as chloroplasts, are involved in photosynthesis and also contain their own DNA. This DNA is separate from the DNA found in the nucleus of the cell.

    Rate this question:

  • 24. 
    Which type of mutation is the following figure? - ProProfs

    Which type of mutation is the following figure?

    • Deletion

    • Insertion

    • Inversion of a part 180o.

    • Exchange segments between two non-homologous chromosomes.

    Correct Answer
    A. Exchange segments between two non-homologous chromosomes.
    Explanation
    The given figure represents an exchange of segments between two non-homologous chromosomes. This type of mutation is known as a chromosomal translocation, where a segment of one chromosome breaks off and attaches to a non-homologous chromosome. This can lead to changes in the structure and function of the affected chromosomes, potentially causing genetic disorders or abnormalities.

    Rate this question:

  • 25. 

    Cells of Eukaryotes contain a number of DNA molecules equals to ……. number of chromosomes inside it.

    • Quarter

    • Half

    • Double

    • Same

    Correct Answer
    A. Same
    Explanation
    The correct answer is "Same." Eukaryotic cells contain a number of DNA molecules equal to the number of chromosomes inside them. This means that each chromosome in a eukaryotic cell contains a single DNA molecule. Therefore, the number of DNA molecules is the same as the number of chromosomes.

    Rate this question:

  • 26. 

    Which of the following does not represent coding sequences in the DNA?

    • Most of prokaryotic genome

    • More than 30% of Eukaryotic genome

    • Sequences for synthesizing proteins

    • Sequences for synthesizing RNA 

    Correct Answer
    A. More than 30% of Eukaryotic genome
    Explanation
    More than 30% of the Eukaryotic genome does not represent coding sequences in the DNA. This means that less than 30% of the Eukaryotic genome is involved in synthesizing proteins or RNA. The other options, such as most of the prokaryotic genome and sequences for synthesizing proteins and RNA, do represent coding sequences in the DNA.

    Rate this question:

  • 27. 

    Suppose that all of the following are non-coding sequences of nucleotides, which of them is a Satellite DNA?

    • GGAATAGGACCTGAACTGGAACAAGATCT

    • GTTACCGGAACACCTGGGATCGTAGAACT

    • GGAACTGGAACTGAACTGGAACTGGAACT

    • TGACCTGGTACTACACTGACGACTGGAACT

    Correct Answer
    A. GGAACTGGAACTGAACTGGAACTGGAACT
  • 28. 

    DNA can serve as a template for DNA or RNA synthesis when it is in the form of …..

    • String of nucleosomes

    • Condensed chromatin

    • Coiled nucleosomes

    • Any of the previous

    Correct Answer
    A. String of nucleosomes
    Explanation
    DNA can serve as a template for DNA or RNA synthesis when it is in the form of a string of nucleosomes. Nucleosomes are the basic structural units of chromatin, consisting of DNA wrapped around histone proteins. This coiled structure allows for efficient packaging of DNA and regulates gene expression. When DNA is in the form of a string of nucleosomes, it is accessible for transcription and replication, making it a suitable template for DNA or RNA synthesis.

    Rate this question:

  • 29. 

    If the DNA double helix in a somatic cell was unwound, so its length would be about ……….. cm.

    • 20

    • 100

    • 150

    • 200

    Correct Answer
    A. 200
    Explanation
    If the DNA double helix in a somatic cell was unwound, its length would be about 200 cm. This is because the DNA double helix consists of two strands that are tightly coiled around each other, forming a twisted ladder shape. When the helix is unwound, the two strands separate and straighten out, resulting in a longer length.

    Rate this question:

  • 30. 

    When can a mutation be passed on to offspring?

    • Only when the mutation is present during or occurs during mitosis

    • Only when the mutation is present during or occurs during meiosis

    • When the mutation occurs during mitosis or meiosis

    • When the mutation occurs in somatic cells

    Correct Answer
    A. Only when the mutation is present during or occurs during meiosis
    Explanation
    A mutation can be passed on to offspring only when it is present during or occurs during meiosis. Meiosis is the process of cell division that produces gametes (sperm and egg cells) in sexually reproducing organisms. During meiosis, genetic material is shuffled and divided, resulting in the formation of haploid cells with unique combinations of genes. If a mutation is present in the DNA of the parent's reproductive cells (sperm or egg), it can be passed on to the offspring. Mutations that occur during mitosis or in somatic cells (non-reproductive cells) are not passed on to offspring.

    Rate this question:

  • 31. 

    What is the relationship among DNA, a gene, and a chromosome?

    • A chromosome contains hundreds of genes, which are composed of DNA.

    • A chromosome contains hundreds of genes, which are composed of protein.

    • A gene contains hundreds of chromosomes, which are composed of protein.

    • A gene is composed of DNA with no relationship to a chromosome.

    Correct Answer
    A. A chromosome contains hundreds of genes, which are composed of DNA.
    Explanation
    A chromosome is a structure in the cell that contains genes. Genes are segments of DNA that provide instructions for making proteins. Therefore, a chromosome contains multiple genes, and these genes are composed of DNA.

    Rate this question:

  • 32. 

    The spontaneous mutation originates by itself without any human interference. It may be due to ……….

    • Ultra violet

    • Nitrous acid

    • Mustard gas

    • Colchicine

    Correct Answer
    A. Ultra violet
    Explanation
    Spontaneous mutations can occur naturally without any external factors or human interference. One possible cause of spontaneous mutations is exposure to ultraviolet (UV) radiation. UV radiation can cause damage to the DNA molecule, leading to changes in the genetic code and the occurrence of mutations. Therefore, the correct answer is Ultra violet.

    Rate this question:

  • 33. 

    What will be the effect of a deletion mutation that happens in a non-coding sequence of nucleotides on the DNA molecule?

    • Organism will die

    • Organism will develop serious problems due to absence of the gene and its product

    • Mild effect on the phenotype

    • No effect

    Correct Answer
    A. No effect
    Explanation
    A deletion mutation in a non-coding sequence of nucleotides will have no effect on the DNA molecule because non-coding sequences do not code for proteins or functional RNA molecules. These sequences are not involved in the production of gene products, so any mutation occurring in them will not impact the organism's phenotype or cause any significant problems. Therefore, the deletion mutation will have no effect on the organism.

    Rate this question:

  • 34. 

    What makes the DNA tightly bound to histones?

    • Because the tightly coiled strings of nucleosomes are arranged in large loops.

    • Due to the strong binding between negatively charged amino acids of histones and the positively charged phosphate groups of DNA.

    • Because histones play a role in the spatial organization of the DNA within the nucleus.

    • So that the regulatory proteins could determine whether or not the DNA code is used to make RNA, proteins and enzymes.

    Correct Answer
    A. Due to the strong binding between negatively charged amino acids of histones and the positively charged phosphate groups of DNA.
    Explanation
    The DNA is tightly bound to histones due to the strong binding between the negatively charged amino acids of histones and the positively charged phosphate groups of DNA. This electrostatic interaction between the opposite charges helps to stabilize the DNA-histone complex and keeps the DNA tightly wrapped around the histones.

    Rate this question:

  • 35. 

    Each cell expresses, or turns on, only a fraction of its genes. The rest of the genes are turned off. This is done by the action of .....

    • Histones

    • Nucleosomes

    • Regulatory proteins

    • Other structural proteins

    Correct Answer
    A. Regulatory proteins
    Explanation
    Regulatory proteins are responsible for turning on or off specific genes within a cell. They bind to specific DNA sequences and either enhance or inhibit the transcription of those genes. This process allows cells to control gene expression and ensure that only the necessary genes are turned on at any given time. Histones and nucleosomes are involved in packaging and organizing DNA, while other structural proteins provide support and structure to the cell. However, neither of these directly regulate gene expression like regulatory proteins do.

    Rate this question:

  • 36. 

    The number of free phosphate groups in the plasmid is ……..

    • Zero

    • 1

    • 2

    • 4

    Correct Answer
    A. Zero
    Explanation
    A plasmid is a small, circular DNA molecule that is separate from the chromosomal DNA in a cell. It usually contains genes that provide some advantage to the organism, such as antibiotic resistance. In a plasmid, the phosphate groups are part of the DNA backbone, and they are essential for the stability and structure of the molecule. However, in this question, the correct answer is zero, which suggests that there are no free phosphate groups in the plasmid. This implies that the phosphate groups are either bound to other molecules or are not present in the plasmid at all.

    Rate this question:

  • 37. 

    DNA replication in Yeast fungus takes place in ………

    • Nucleus only

    • Mitochondria only

    • Both cytoplasm and nucleolus

    • Both nucleus and cytoplasm

    Correct Answer
    A. Both nucleus and cytoplasm
    Explanation
    DNA replication in yeast fungus takes place in both the nucleus and cytoplasm. The nucleus is the primary site for DNA replication, where the majority of the replication machinery is located. However, yeast cells also have a small amount of DNA replication occurring in the cytoplasm, specifically in the mitochondria. This is because mitochondria have their own circular DNA molecules that need to be replicated independently from the nuclear DNA. Therefore, DNA replication in yeast fungus occurs in both the nucleus and cytoplasm.

    Rate this question:

  • 38. 
    In the figure below, the binding between (X) and (Y) is done by the help of ……... - ProProfs

    In the figure below, the binding between (X) and (Y) is done by the help of ……...

    • Ligase enzyme activity

    • Difference of charges at the binding point

    • Formation of hydrogen bonds

    • Dehydration reaction

    Correct Answer
    A. Difference of charges at the binding point
  • 39. 

    Which of the following statements about DNA in prokaryotic cells is correct? 

    • The DNA is coiled compactly, so if it was stretched out, it would be much longer than the cell itself.

    • The DNA is found loosely floating within the cell and is formed of less than 100 nucleotides.

    • The majority of the DNA does not code for proteins and has no obvious function.

    • The nitrogenous bases that are contained in the DNA are A, T, G, and U.

    • The DNA is tightly wound around specialized proteins called histones and coiled into chromatin.

    Correct Answer
    A. The DNA is coiled compactly, so if it was stretched out, it would be much longer than the cell itself.
    Explanation
    The correct answer is that the DNA in prokaryotic cells is coiled compactly, so if it was stretched out, it would be much longer than the cell itself. This is because prokaryotic cells have a small and simple structure, so their DNA needs to be tightly packed to fit inside the cell. This compact coiling allows for efficient storage of genetic information in a small space.

    Rate this question:

  • 40. 
    The diagram provided shows a simplified outline of the different types of gene mutations that can occur in a strand of DNA. Which diagram, demonstrates an insertion mutation? - ProProfs

    The diagram provided shows a simplified outline of the different types of gene mutations that can occur in a strand of DNA. Which diagram, demonstrates an insertion mutation?

    • 1

    • 2

    • 3

    • None of them

    Correct Answer
    A. 3
    Explanation
    Diagram 3 shows an insertion mutation because it has an extra nucleotide inserted into the DNA sequence compared to the original sequence. This type of mutation results in a shift in the reading frame and can lead to significant changes in the resulting protein.

    Rate this question:

  • 41. 
    The diagram provided shows a simplified outline of the different types of gene mutations that can occur in a strand of DNA. Which diagram, demonstrate a deletion mutation? - ProProfs

    The diagram provided shows a simplified outline of the different types of gene mutations that can occur in a strand of DNA. Which diagram, demonstrate a deletion mutation?

    • 1

    • 2

    • 3

    • None of them

    Correct Answer
    A. 1
    Explanation
    Diagram 1 demonstrates a deletion mutation because it shows a section of the DNA strand that has been removed or deleted. This is indicated by the gap in the DNA strand where a section of nucleotides is missing.

    Rate this question:

  • 42. 

    Which of the following types of mutations can cause a frameshift (shift mutation) in a DNA sequence?

    • Insertion or deletion

    • Deletion only

    • Insertion or inversion

    • Substitution or saturation

    • Substitution only

    Correct Answer
    A. Insertion or deletion
    Explanation
    Insertion or deletion mutations can cause a frameshift in a DNA sequence. This is because insertion or deletion of nucleotides can disrupt the reading frame of the sequence, shifting the codon alignment and potentially leading to a completely different amino acid sequence during translation. In contrast, substitution mutations only change one nucleotide at a time and do not typically cause a frameshift. Inversion mutations involve rearranging sections of DNA but do not result in a frameshift. Saturation mutations refer to a high frequency of mutations in a specific region but do not directly cause frameshifts.

    Rate this question:

  • 43. 
    The diagram provided shows a simplified outline of the different types of gene mutations that can occur in a strand of DNA. Which diagram, demonstrate an inversion of nucleotides? - ProProfs

    The diagram provided shows a simplified outline of the different types of gene mutations that can occur in a strand of DNA. Which diagram, demonstrate an inversion of nucleotides?

    • 1

    • 2

    • 3

    • None of them

    Correct Answer
    A. None of them
    Explanation
    None of the diagrams demonstrate an inversion of nucleotides. An inversion mutation occurs when a segment of DNA is reversed within the chromosome. In the given diagrams, there is no indication of any segment being reversed or inverted. Therefore, none of the diagrams represent an inversion mutation.

    Rate this question:

  • 44. 

    Which one do you like?

    • Option 1

    • Option 2

    • Option 3

    • Option 4

    Correct Answer
    A. Option 1
  • 45. 

    The number of free phosphate groups in the bacterial DNA molecule is ………

    • 4

    • 2

    • 1

    • Zero

    Correct Answer
    A. Zero
    Explanation
    Bacterial DNA molecules do not contain free phosphate groups. The phosphate groups in DNA are covalently bonded to the deoxyribose sugar molecules, forming the backbone of the DNA strand. Therefore, the correct answer is zero.

    Rate this question:

  • 46. 

    What type of mutation happens to just one base?

    • Chromosome mutation

    • Point mutation

    • DNA mutation

    • Inversion mutation

    Correct Answer
    A. Point mutation
    Explanation
    Point mutation refers to a type of mutation that occurs when a single base in the DNA sequence is changed, deleted, or inserted. This type of mutation can lead to a change in the amino acid sequence during protein synthesis, potentially affecting the function of the protein. Chromosome mutation involves changes in the structure or number of chromosomes, DNA mutation is a broad term that encompasses any change in the DNA sequence, and inversion mutation refers to a type of chromosomal rearrangement where a segment of the chromosome is reversed.

    Rate this question:

  • 47. 

    The non-histone chromatins are a large group of heterogeneous proteins that play a role in organization and compaction of the chromosome into higher order structures. These proteins are found in ........

    • Escherichia coli

    • Bacteriophage

    • Virulent (S) type of pneumonia bacteria

    • Amoeba

    • Coronavirus

    Correct Answer
    A. Amoeba
  • 48. 

    All of the following structures of bacteria contain protein except ---------.

    • Plasmids

    • Ribosomes

    • Flagella

    • Cell membrane

    Correct Answer
    A. Plasmids
    Explanation
    Plasmids are small, circular pieces of DNA that are separate from the bacterial chromosome. They can contain genes that provide certain advantages to the bacteria, such as antibiotic resistance. However, plasmids do not contain proteins themselves. Ribosomes, flagella, and the cell membrane are all structures in bacteria that do contain proteins.

    Rate this question:

  • 49. 

    Which of the following ratios between phosphorus and sulphur in a sample of a genetic material, indicates that it belongs to a bacterial cell?

    • Phosphorus 50% : Sulphur 50%

    • Phosphorous 65% : Sulphur 44%

    • Phosphorus 73 : Sulphur 27%

    • Phosphorus 100% : Sulphur 0%

    Correct Answer
    A. Phosphorus 100% : Sulphur 0%
    Explanation
    A bacterial cell typically contains a higher ratio of phosphorus to sulfur compared to other organisms. This is because phosphorus is an essential component of DNA and RNA, which are genetic materials found in all cells. In contrast, sulfur is not as abundant in genetic material and is more commonly found in proteins. Therefore, a ratio of phosphorus 100% to sulfur 0% suggests that the genetic material belongs to a bacterial cell.

    Rate this question:

Quiz Review Timeline (Updated): Jun 7, 2023 +

Our quizzes are rigorously reviewed, monitored and continuously updated by our expert board to maintain accuracy, relevance, and timeliness.

  • Current Version
  • Jun 07, 2023
    Quiz Edited by
    ProProfs Editorial Team
  • Jul 12, 2020
    Quiz Created by
    Samy

Recent Quizzes

Crack the Code of Aging: Telomeres and Aging Quiz Crack the Code of Aging: Telomeres and Aging Quiz
Taxonomy Test: DNA Barcoding in Species Identification Quiz Taxonomy Test: DNA Barcoding in Species Identification Quiz
Epigenetic Test: DNA Methylation Patterns Quiz for Beginners Epigenetic Test: DNA Methylation Patterns Quiz for Beginners
Exploring Ancient Genetics: The Ancient DNA Studies Quiz Exploring Ancient Genetics: The Ancient DNA Studies Quiz
How Much Do You Know About Epigenetics and Genetic Engineering? How Much Do You Know About Epigenetics and Genetic Engineering?
How Well Do You Understand Gene Editing Techniques? How Well Do You Understand Gene Editing Techniques?
Back to Top Back to top
Advertisement
×

Wait!
Here's an interesting quiz for you.

We have other quizzes matching your interest.