Forensics: DNA - the basics

1. Which combination will make genetic male?

XY

XX

The combination XY will make a genetic male. In humans, males typically have one X chromosome and one Y chromosome, while females have two X chromosomes. The presence of the Y chromosome determines the development of male characteristics. Therefore, XY is the correct combination for a genetic male.

Explanation

The combination XY will make a genetic male. In humans, males typically have one X chromosome and one Y chromosome, while females have two X chromosomes. The presence of the Y chromosome determines the development of male characteristics. Therefore, XY is the correct combination for a genetic male.

2. How is Mitochondrial DNA inherited?

From mom

From dad

Mitochondrial DNA is inherited exclusively from the mother. This is because sperm cells do not typically pass on their mitochondria to the offspring during fertilization. Only the egg cell contributes mitochondria to the developing embryo, which means that the mitochondrial DNA is passed down from generation to generation through the maternal line.

Explanation

Mitochondrial DNA is inherited exclusively from the mother. This is because sperm cells do not typically pass on their mitochondria to the offspring during fertilization. Only the egg cell contributes mitochondria to the developing embryo, which means that the mitochondrial DNA is passed down from generation to generation through the maternal line.

3. This is a partial sequence of one strand of DNA. Choose the correct complimentary strand of DNA.AATTCGCGAT

UUAAGCGCUA

TTAACCGCGTA

TTAAGCGCTA

CCGGATATCG

A and T pair together; C and G pair together. U (Uracil) is NOT in DNA; Uracil is found (instead of Thymine) in RNA and would pair with Adenine (A)

Explanation

A and T pair together; C and G pair together. U (Uracil) is NOT in DNA; Uracil is found (instead of Thymine) in RNA and would pair with Adenine (A)

4. How many chromosomes in the human nucleus?

23 chromosomes

23 pairs of chromosomes

46 pairs of chromosomes

23 PAIRS of chromosomes -- 23 from mom and 23 from dad

Explanation

23 PAIRS of chromosomes -- 23 from mom and 23 from dad

5. What are the 3 parts of the nucleotide (smallest unit of DNA)?

Sugar (ribose), Phosphate group, Nitrogenous bases: A, T, C, G

Sugar (deoxyribose), Phosphate group, Nitrogenous bases: A, U, C, G

Sugar (deoxyribose), Sulfate group, Nitrogenous bases: A, T, C, G

Sugar (deoxyribose), Phosphate group, Nitrogenous bases: A, T, C, G

The three parts of a nucleotide, the smallest unit of DNA, are sugar (deoxyribose), phosphate group, and nitrogenous bases: A, T, C, G.

Explanation

The three parts of a nucleotide, the smallest unit of DNA, are sugar (deoxyribose), phosphate group, and nitrogenous bases: A, T, C, G.

6. Which cells have nuclear DNA?

Red Blood Cells

White Blood Cells

Hair shaft (NOT the root)

Fingernails

Red blood cells do NOT have a nucleus, so they do NOT have nuclear DNA. Fingernails and hair to do NOT have nuclear DNA. In order for hair to have nuclear DNA, it must be ripped from the head and have skin cells (with nuclei) attached to it.

Explanation

Red blood cells do NOT have a nucleus, so they do NOT have nuclear DNA. Fingernails and hair to do NOT have nuclear DNA. In order for hair to have nuclear DNA, it must be ripped from the head and have skin cells (with nuclei) attached to it.

7. Which is an example of Short Tandem Repeats?

GCAATGCTCGG

CCGGTTGATAGATAGATAGATACCGGTT

STR - between 3 to 7 base pairs that repeat. GATA is an example.

Explanation

STR - between 3 to 7 base pairs that repeat. GATA is an example.

8. Which of the following would NOT, likely, be a good location for nuclear DNA?

Saliva on an open can of soda

Cigarette butt

Handle of a knife

Blood

The handle of a knife would not likely be a good location for nuclear DNA because it is a non-biological surface that is constantly being touched and exposed to various environmental factors. Nuclear DNA is typically found within the cells of living organisms, such as saliva, blood, or even on a cigarette butt. However, the handle of a knife does not provide a suitable environment for the preservation and protection of DNA.

Explanation

The handle of a knife would not likely be a good location for nuclear DNA because it is a non-biological surface that is constantly being touched and exposed to various environmental factors. Nuclear DNA is typically found within the cells of living organisms, such as saliva, blood, or even on a cigarette butt. However, the handle of a knife does not provide a suitable environment for the preservation and protection of DNA.

9. Choose ALL that are correct!

XX chromosomes indicates a female.

1/2 your nuclear DNA came from your mom.

You mitochondrial DNA came from your dad.

Forensic science focuses on the non-coding areas of DNA.

In DNA: Adenine (A) pairs with Cytosine (C)

Mitochondrial DNA is inherited from your mom.
Adenine (A) pairs with Thymine (T) in DNA. Cytosine (C) pairs with Guanine (G)

Explanation

Mitochondrial DNA is inherited from your mom.
Adenine (A) pairs with Thymine (T) in DNA. Cytosine (C) pairs with Guanine (G)

Submit

10. True or False: DNA profiling (DNA fingerprinting) is show unique results for all individuals.

True

False

DNA fingerprinting (DNA profiling) reveals that IDENTICAL twins have IDENTICAL DNA. (Scientists are currently working on ways to distinguish twins based on changes to genes - additions of methyl groups -- as a twin ages).

Explanation

DNA fingerprinting (DNA profiling) reveals that IDENTICAL twins have IDENTICAL DNA. (Scientists are currently working on ways to distinguish twins based on changes to genes - additions of methyl groups -- as a twin ages).

Forensics: DNA - The Basics