Forensics: DNA - The Basics
Transcription is the process by which DNA is copied to mRNA, which carries the information needed for protein synthesis. We got to cover the whole process in class this past week. If you like answering specifically designed questions that the future or specific information about transcription and translation try out this quiz. It is a simple quiz; therefore, it will be easy to answer.
- 1.Which cells have nuclear DNA?
- A.
Red Blood Cells
- B.
White Blood Cells
- C.
Hair shaft (NOT the root)
- D.
Fingernails
- 2.Choose ALL that are correct!
- A.
XX chromosomes indicates a female.
- B.
1/2 your nuclear DNA came from your mom.
- C.
You mitochondrial DNA came from your dad.
- D.
Forensic science focuses on the non-coding areas of DNA.
- E.
In DNA: Adenine (A) pairs with Cytosine (C)
- 3.This is a partial sequence of one strand of DNA. Choose the correct complimentary strand of DNA.AATTCGCGAT
- A.
UUAAGCGCUA
- B.
TTAACCGCGTA
- C.
TTAAGCGCTA
- D.
CCGGATATCG
- 4.True or False: DNA profiling (DNA fingerprinting) is show unique results for all individuals.
- A.
True
- B.
False
- 5.What are the 3 parts of the nucleotide (smallest unit of DNA)?
- A.
Sugar (ribose), Phosphate group, Nitrogenous bases: A, T, C, G
- B.
Sugar (deoxyribose), Phosphate group, Nitrogenous bases: A, U, C, G
- C.
Sugar (deoxyribose), Sulfate group, Nitrogenous bases: A, T, C, G
- D.
Sugar (deoxyribose), Phosphate group, Nitrogenous bases: A, T, C, G
- 6.How many chromosomes in the human nucleus?
- A.
23 chromosomes
- B.
23 pairs of chromosomes
- C.
46 pairs of chromosomes
- 7.Which combination will make genetic male?
- A.
XY
- B.
XX
- 8.How is Mitochondrial DNA inherited?
- A.
From mom
- B.
From dad
- 9.Which is an example of Short Tandem Repeats?
- A.
GCAATGCTCGG
- B.
CCGGTTGATAGATAGATAGATACCGGTT
- 10.Which of the following would NOT, likely, be a good location for nuclear DNA?
- A.
Saliva on an open can of soda
- B.
Cigarette butt
- C.
Handle of a knife
- D.
Blood
Questions: 10 | Attempts: 8296 | Last updated: Jul 13, 2021
-
Sample QuestionDNA is found in the ___ of a cell.
Questions: 10 | Attempts: 5533 | Last updated: Dec 31, 2012
-
Sample QuestionWhat will most likely be the effect of the change in the DNA molecule ?
Questions: 20 | Attempts: 4199 | Last updated: May 4, 2016
-
Sample QuestionWhich of the following is TRUE about mutation
Back to top