Forensics: DNA - The Basics

Approved & Edited by ProProfs Editorial Team
The editorial team at ProProfs Quizzes consists of a select group of subject experts, trivia writers, and quiz masters who have authored over 10,000 quizzes taken by more than 100 million users. This team includes our in-house seasoned quiz moderators and subject matter experts. Our editorial experts, spread across the world, are rigorously trained using our comprehensive guidelines to ensure that you receive the highest quality quizzes.
Learn about Our Editorial Process
| By Kwchiro
K
Kwchiro
Community Contributor
Quizzes Created: 40 | Total Attempts: 383,150
Questions: 10 | Attempts: 4,070

SettingsSettingsSettings
Forensics: DNA - The Basics - Quiz

Transcription is the process by which DNA is copied to mRNA, which carries the information needed for protein synthesis. We got to cover the whole process in class this past week. If you like answering specifically designed questions that the future or specific information about transcription and translation try out this quiz. It is a simple quiz; therefore, it will be easy to answer.


Questions and Answers
  • 1. 

    Which cells have nuclear DNA?

    • A.

      Red Blood Cells

    • B.

      White Blood Cells

    • C.

      Hair shaft (NOT the root)

    • D.

      Fingernails

    Correct Answer
    B. White Blood Cells
    Explanation
    Red blood cells do NOT have a nucleus, so they do NOT have nuclear DNA. Fingernails and hair to do NOT have nuclear DNA. In order for hair to have nuclear DNA, it must be ripped from the head and have skin cells (with nuclei) attached to it.

    Rate this question:

  • 2. 

    Choose ALL that are correct!

    • A.

      XX chromosomes indicates a female.

    • B.

      1/2 your nuclear DNA came from your mom.

    • C.

      You mitochondrial DNA came from your dad.

    • D.

      Forensic science focuses on the non-coding areas of DNA.

    • E.

      In DNA: Adenine (A) pairs with Cytosine (C)

    Correct Answer(s)
    A. XX chromosomes indicates a female.
    B. 1/2 your nuclear DNA came from your mom.
    D. Forensic science focuses on the non-coding areas of DNA.
    Explanation
    Mitochondrial DNA is inherited from your mom.
    Adenine (A) pairs with Thymine (T) in DNA. Cytosine (C) pairs with Guanine (G)

    Rate this question:

  • 3. 

    This is a partial sequence of one strand of DNA. Choose the correct complimentary strand of DNA.​AATTCGCGAT

    • A.

      UUAAGCGCUA

    • B.

      TTAACCGCGTA

    • C.

      TTAAGCGCTA

    • D.

      CCGGATATCG

    Correct Answer
    C. TTAAGCGCTA
    Explanation
    A and T pair together; C and G pair together. U (Uracil) is NOT in DNA; Uracil is found (instead of Thymine) in RNA and would pair with Adenine (A)

    Rate this question:

  • 4. 

    True or False: DNA profiling (DNA fingerprinting) is show unique results for all individuals.

    • A.

      True

    • B.

      False

    Correct Answer
    B. False
    Explanation
    DNA fingerprinting (DNA profiling) reveals that IDENTICAL twins have IDENTICAL DNA. (Scientists are currently working on ways to distinguish twins based on changes to genes - additions of methyl groups -- as a twin ages).

    Rate this question:

  • 5. 

    What are the 3 parts of the nucleotide (smallest unit of DNA)?

    • A.

      Sugar (ribose), Phosphate group, Nitrogenous bases: A, T, C, G

    • B.

      Sugar (deoxyribose), Phosphate group, Nitrogenous bases: A, U, C, G

    • C.

      Sugar (deoxyribose), Sulfate group, Nitrogenous bases: A, T, C, G

    • D.

      Sugar (deoxyribose), Phosphate group, Nitrogenous bases: A, T, C, G

    Correct Answer
    D. Sugar (deoxyribose), pHospHate group, Nitrogenous bases: A, T, C, G
    Explanation
    The three parts of a nucleotide, the smallest unit of DNA, are sugar (deoxyribose), phosphate group, and nitrogenous bases: A, T, C, G.

    Rate this question:

  • 6. 

    How many chromosomes in the human nucleus?

    • A.

      23 chromosomes

    • B.

      23 pairs of chromosomes

    • C.

      46 pairs of chromosomes

    Correct Answer
    B. 23 pairs of chromosomes
    Explanation
    23 PAIRS of chromosomes -- 23 from mom and 23 from dad

    Rate this question:

  • 7. 

    Which combination will make genetic male?

    • A.

      XY

    • B.

      XX

    Correct Answer
    A. XY
    Explanation
    The combination XY will make a genetic male. In humans, males typically have one X chromosome and one Y chromosome, while females have two X chromosomes. The presence of the Y chromosome determines the development of male characteristics. Therefore, XY is the correct combination for a genetic male.

    Rate this question:

  • 8. 

    How is Mitochondrial DNA inherited?

    • A.

      From mom

    • B.

      From dad

    Correct Answer
    A. From mom
    Explanation
    Mitochondrial DNA is inherited exclusively from the mother. This is because sperm cells do not typically pass on their mitochondria to the offspring during fertilization. Only the egg cell contributes mitochondria to the developing embryo, which means that the mitochondrial DNA is passed down from generation to generation through the maternal line.

    Rate this question:

  • 9. 

    Which is an example of Short Tandem Repeats?

    • A.

      GCAATGCTCGG

    • B.

      CCGGTTGATAGATAGATAGATACCGGTT

    Correct Answer
    B. CCGGTTGATAGATAGATAGATACCGGTT
    Explanation
    STR - between 3 to 7 base pairs that repeat. GATA is an example.

    Rate this question:

  • 10. 

    Which of the following would NOT, likely, be a good location for nuclear DNA?

    • A.

      Saliva on an open can of soda

    • B.

      Cigarette butt

    • C.

      Handle of a knife

    • D.

      Blood

    Correct Answer
    C. Handle of a knife
    Explanation
    The handle of a knife would not likely be a good location for nuclear DNA because it is a non-biological surface that is constantly being touched and exposed to various environmental factors. Nuclear DNA is typically found within the cells of living organisms, such as saliva, blood, or even on a cigarette butt. However, the handle of a knife does not provide a suitable environment for the preservation and protection of DNA.

    Rate this question:

Quiz Review Timeline +

Our quizzes are rigorously reviewed, monitored and continuously updated by our expert board to maintain accuracy, relevance, and timeliness.

  • Current Version
  • Dec 19, 2023
    Quiz Edited by
    ProProfs Editorial Team
  • Oct 30, 2015
    Quiz Created by
    Kwchiro
Back to Top Back to top
Advertisement
×

Wait!
Here's an interesting quiz for you.

We have other quizzes matching your interest.