Forensics: DNA - The Basics
Transcription is the process by which DNA is copied to mRNA, which carries the information needed for protein synthesis. We got to cover the whole process in class this past week. If you like answering specifically designed questions that the future or specific information about transcription and translation try out this quiz. It is a simple quiz; therefore, it will be easy to answer.
- 1.Which cells have nuclear DNA?
- A.
Red Blood Cells
- B.
White Blood Cells
- C.
Hair shaft (NOT the root)
- D.
Fingernails
- 2.Choose ALL that are correct!
- A.
XX chromosomes indicates a female.
- B.
1/2 your nuclear DNA came from your mom.
- C.
You mitochondrial DNA came from your dad.
- D.
Forensic science focuses on the non-coding areas of DNA.
- E.
In DNA: Adenine (A) pairs with Cytosine (C)
- 3.This is a partial sequence of one strand of DNA. Choose the correct complimentary strand of DNA.AATTCGCGAT
- A.
UUAAGCGCUA
- B.
TTAACCGCGTA
- C.
TTAAGCGCTA
- D.
CCGGATATCG
- 4.True or False: DNA profiling (DNA fingerprinting) is show unique results for all individuals.
- A.
True
- B.
False
- 5.What are the 3 parts of the nucleotide (smallest unit of DNA)?
- A.
Sugar (ribose), Phosphate group, Nitrogenous bases: A, T, C, G
- B.
Sugar (deoxyribose), Phosphate group, Nitrogenous bases: A, U, C, G
- C.
Sugar (deoxyribose), Sulfate group, Nitrogenous bases: A, T, C, G
- D.
Sugar (deoxyribose), Phosphate group, Nitrogenous bases: A, T, C, G
- 6.How many chromosomes in the human nucleus?
- A.
23 chromosomes
- B.
23 pairs of chromosomes
- C.
46 pairs of chromosomes
- 7.Which combination will make genetic male?
- A.
XY
- B.
XX
- 8.How is Mitochondrial DNA inherited?
- A.
From mom
- B.
From dad
- 9.Which is an example of Short Tandem Repeats?
- A.
GCAATGCTCGG
- B.
CCGGTTGATAGATAGATAGATACCGGTT
- 10.Which of the following would NOT, likely, be a good location for nuclear DNA?
- A.
Saliva on an open can of soda
- B.
Cigarette butt
- C.
Handle of a knife
- D.
Blood
Questions: 10 | Attempts: 10238 | Last updated: Mar 22, 2022
-
Sample QuestionDNA is found in the ___ of a cell.
Questions: 10 | Attempts: 6045 | Last updated: Mar 21, 2022
-
Sample QuestionWhat will most likely be the effect of the change in the DNA molecule ?
Questions: 20 | Attempts: 5263 | Last updated: Mar 22, 2022
-
Sample QuestionWhich of the following is TRUE about mutation
- Abdomen Quizzes
- Addiction Quizzes
- Aging Quizzes
- Arthritis Quizzes
- Baby Care Quizzes
- Beauty Quizzes
- Blood Quizzes
- Body Quizzes
- Bone Quizzes
- Brain Quizzes
- Child Health Quizzes
- Dermatology Quizzes
- Digestive System Quizzes
- Disease Quizzes
- Fertility Quizzes
- First Aid Quizzes
- Hair Care Quizzes
- Health And Nutrition Quizzes
- Health And Wellness Quizzes
- Health Policy Quizzes
- Health Psychology Quizzes
- Health Strategy Quizzes
- Health Worldwide Quizzes
- Hearing Quizzes
- Heart Quizzes
- Hospital Quizzes
- Illness Quizzes
- Injury Quizzes
- Kidney Quizzes
- Liver Quizzes
- Lung Quizzes
- Medical Quizzes
- Mental Health Quizzes
- Nose Quizzes
- Nutrition Quizzes
- Obesity Quizzes
- Ophthalmology Quizzes
- Patient Quizzes
- Patient Care Quizzes
- Pharmacy Quizzes
- Pregnancy Quizzes
- Puberty Quizzes
- Public Health Quizzes
- Respiratory System Quizzes
- Sleep Quizzes
- Stress Quizzes
- Surgery Quizzes
- Surgical Instruments Quizzes
- Throat Quizzes
- Weight Quizzes
- Wellness Quizzes
Back to top