Επαναληπτικό τεστ στη βιολογία προσανατολισμού (1ο, 2ο, 4ο κεφάλαιο)

25 Questions | Total Attempts: 138

SettingsSettingsSettings
Επαναληπτικό τεστ στη βιολογία προσανατολισμού (1ο, 2ο, 4ο κεφάλαιο) - Quiz

.


Questions and Answers
  • 1. 
    Οι μεταγραφικοί παράγοντες αποτελούνται από:
    • A. 

      ριβονουκλεοτίδια.

    • B. 

      δεοξιριβονουκλεοτίδια.

    • C. 

      αμινοξέα.

    • D. 

      RNA συνδεδεμένο με πρωτεΐνες.

  • 2. 
    Σε ένα μόριο tRNA υπάρχει/-ουν:
    • A. 

      5' και 3' αμετάφραστες περιοχές.

    • B. 

      κωδικόνιο έναρξης.

    • C. 

      κωδικόνιο λήξης.

    • D. 

      προσανατολισμός 5' -> 3'.

  • 3. 
    Για την έκφραση των δομικών γονιδίων του οπερονίου της λακτόζης δεν είναι απαραίτητα:
    • A. 

      τα ριβονουκλεοπρωτεϊνικά σωματίδια.

    • B. 

      το σύμπλοκο έναρξης της μετάφρασης.

    • C. 

      τα κωδικόνια λήξης.

    • D. 

      το πολύσωμα.

  • 4. 
    Σε ένα πολύσωμα περιέχονται 5 ριβοσώματα. Αν το mRNA περιέχει 70 κωδικόνια, μεταξύ των 2 ριβοσωμάτων παρεμβάλλονται 10 κωδικόνια και το πρώτο ριβόσωμα βρίσκεται πάνω από το κωδικόνιο λήξης, πόσα αμινοξέα έχει προς το παρόν το πεπτίδιο που συνθέτει το τελευταίο ριβόσωμα (θεωρώντας ότι και οι 2 εισδοχές του είναι κατειλημμένες);
    • A. 

      20

    • B. 

      22

    • C. 

      25

    • D. 

      40

  • 5. 
    Μπορεί να είναι γραμμικό:
    • A. 

      πλασμίδιο

    • B. 

      κύριο βακτηριακό μόριο DNA

    • C. 

      μιτοχονδριακό DNA

    • D. 

      χλωροπλαστικό DNA

  • 6. 
    Αν ο γαμέτης ανώτερου θηλαστικού έχει 32 μόρια DNA, πόσα μόρια DNA θα περιέχονται στον καρυότυπό του;
    • A. 

      32

    • B. 

      64

    • C. 

      128

    • D. 

      256

  • 7. 
    Το μόριο tRNA με αντικωδικόνιο 5'UGA3':
    • A. 

      μεταφέρει το αμινοξύ thr.

    • B. 

      μεταφέρει το αμινοξύ ser.

    • C. 

      μεταφέρει το αμινοξύ met.

    • D. 

      δεν μεταφέρει αμινοξύ.

  • 8. 
    Ο Οδυσσέας και ο Αντώνης έχουν ίδιο μιτοχονδριακό DNA και ίδια αλληλουχία βάσεων στο Υ χρωμόσωμά τους. Ο Οδυσσέας και ο Αντώνης είναι:
    • A. 

      πατέρας και γιος.

    • B. 

      αποκλειστικά μονοζυγωτικοί δίδυμοι.

    • C. 

      πρώτα ξαδέρφια.

    • D. 

      αμφιθαλή αδέρφια.

  • 9. 
    Στο ώριμο mRNA δεν περιλαμβάνονται:
    • A. 

      οι 5' και 3΄ αμετάφραστες περιοχές.

    • B. 

      τα εξώνια.

    • C. 

      ο υποκινητής.

    • D. 

      το κωδικόνιο λήξης.

  • 10. 
    Τα αμινοξέα δεν αποτελούν συστατικά:
    • A. 

      της EcoRI.

    • B. 

      της DNA πολυμεράσης

    • C. 

      της ινσουλίνης

    • D. 

      ενός φορέα κλωνοποίησης

  • 11. 
    Σε μια θηλιά αντιγραφής σχηματίζονται 12 πρωταρχικά τμήματα. Τα ασυνεχή τμήματα σε κάθε αλυσίδα είναι:
    • A. 

      11

    • B. 

      6

    • C. 

      5

    • D. 

      4

  • 12. 
    Σωστή απεικόνιση έναρξης της αντιγραφής ενός τμήματος DNA είναι:
    • A. 

      5' GATATGGCACATTTAAATTTCGGAAC3' 3' CUAUAC->

    • B. 

      5' GATATGGCACATTTAAATTTCGGAAC3'                                                 <-GCCTTG5'

    • C. 

      5' GATATGGCACATTTAAATTTCGGAAC3' 3' CTATACC->

    • D. 

      5' GATATGGCACATTTAAATTTCGGAAC3'                                               <-GCCUUG5'

  • 13. 
    Η ακόλουθη αλληλουχία βάσεων αποτελεί κωδική αλυσίδα συνεχούς γονιδίου: 5' GCGCATGCCAACAATAGAGCGCATGAAAA3'  Το γονίδιο μεταγράφεται:
    • A. 

      σε mRNA

    • B. 

      σε tRNA

    • C. 

      και μεταφράζεται σε πενταπεπτίδιο

    • D. 

      και μεταφράζεται σε οπερόνιο

  • 14. 
    Κατά τη μεταγραφή ενός γονιδίου, η RNA πολυμεράση συνδέεται στον υποκινητή, προκαλεί τοπικό ξετύλιγμα και μεταγράφει την αλυσίδα που έχει:
    • A. 

      3' άκρο στον υποκινητή

    • B. 

      5' άκρο στον υποκινητή

    • C. 

      κωδικόνιο έναρξης 5'ΑΤG3'

    • D. 

      κωδικόνιο έναρξης 3'TAC5'

  • 15. 
    Στο οπερόνιο της λακτόζης δεν υπάρχουν:
    • A. 

      αλληλουχίες λήξης της μεταγραφής.

    • B. 

      κωδικόνια λήξης.

    • C. 

      ρυθμιστικές αλληλουχίες.

    • D. 

      εσώνια.

  • 16. 
    Ο παράγοντας VIII είναι μια πρωτεΐνη που συμβάλλει στην πήξη του αίματος και το γονίδιο που την κωδικοποιεί βρίσκεται στο χρωμόσωμα Χ. Ο υποκινητής του γονιδίου αυτού υπάρχει:
    • A. 

      μόνο στα σωματικά κύτταρα ενός φυσιολογικού ατόμου.

    • B. 

      σε όλα τα κύτταρα μιας φυσιολογικής γυναίκας.

    • C. 

      σε όλα τα κύτταρα ενός φυσιολογικού άνδρα.

    • D. 

      στα κύτταρα που επιτελούν την πήξη του αίματος.

  • 17. 
    Σε θρεπτικό υλικό γλυκόζης, στέλεχος E.coli παράγει ποσότητες των τριών ενζύμων που διασπούν τη λακτόζη. Αυτό μπορεί να οφείλεται σε μετάλλαξη:
    • A. 

      στον υποκινητή των τριών δομικών γονιδίων.

    • B. 

      στην πρωτεΐνη καταστολέα ώστε αυτή να μην συνδέεται με την λακτόζη.

    • C. 

      στο ρυθμιστικό γονίδιο, που το κατέστησε ανενεργό.

    • D. 

      στα δομικά γονίδια.

  • 18. 
    Ο χειριστής του οπερονίου της λακτόζης δεν περιέχει:
    • A. 

      άζωτο

    • B. 

      θείο

    • C. 

      άνθρακα

    • D. 

      φώσφορο

  • 19. 
    Η μεταγραφή του γονιδίου μιας πρωτεΐνης Α απαιτεί τους μεταγραφικούς παράγοντες Χ και Υ. Η πρωτεΐνη παράγεται αποκλειστικά σε ανθρώπινα ηπατικά και νευρικά κύτταρα. Αυτό συμβαίνει διότι:
    • A. 

      τα ηπατικά και τα νεφρικά κύτταρα έχουν ίδιους μεταγραφικούς παράγοντες.

    • B. 

      τα ηπατικά και τα νεφρικά κύτταρα έχουν ίδιους υποκινητές.

    • C. 

      οι υπόλοιποι κυτταρικοί τύποι του οργανισμού δεν έχουν τον μεταγραφικό παράγοντα Χ ή τον Υ ή και τους δύο.

    • D. 

      οι υπόλοιποι κυτταρικοί τύποι του οργανισμού δεν έχουν τον υποκινητή του γονιδίου της πρωτεΐνης Α.

  • 20. 
    Σε cDNA βιβλιοθήκη τόσο του παγκρεατικού όσο και του πρόδρομου ερυθροκυττάρου ενός οργανισμού μπορεί να είναι κοινός ο κλώνος του γονιδίου για:
    • A. 

      το tRNA της μεθειονίνης.

    • B. 

      το rRNA.

    • C. 

      την πρωτεΐνη του ριβοσώματος.

    • D. 

      την ινσουλίνη.

  • 21. 
    Η περιοριστική ενδονουκλεάση BamHI αναγνωρίζει  9000 θέσεις στο πυρηνικό DNA ενός σωματικού κυττάρου της γυναίκας. Μετά την επίδρασή της στο πυρηνικό DNA, ο αριθμός των θραυσμάτων που προκύπτουν είναι:
    • A. 

      9001

    • B. 

      9023

    • C. 

      9046

    • D. 

      περισσότερα από 9046

  • 22. 
    Η περιοριστική ενδονουκλεάση DdeI αναγνωρίζει 4000 θέσεις στο πυρηνικό DNA ενός ωαρίου γυναίκας, Μετά την επίδραση στο συνολικό DNA του ωαρίου, ο αριθμός των θραυσμάτων που προκύπτουν είναι:
    • A. 

      4001

    • B. 

      4023

    • C. 

      περισσότερα από 4023

    • D. 

      λιγότερα από 4023

  • 23. 
    ΟΙ 5' και 3' αμετάφρασες περιοχές ενός γονιδίου είναι δυνατόν να κλωνοποιηθούν:
    • A. 

      σε γονιδιωματική βιβλιοθήκη.

    • B. 

      σε cDNA βιβλιοθήκη.

    • C. 

      και με τις 2 βιβλιοθήκες.

    • D. 

      αποκλειστικά με PCR.

  • 24. 
    Γονίδιο βατράχου μεταφέρεται σε πλασμίδιο και το ανασυνδυασμένο πλασμίδιο μετασχηματίζει βακτήριο προκειμένου να παραχθεί σε αυτό η πρωτεΐνη του βατράχου. Το γονίδιο πρέπει:
    • A. 

      να μεταφερθεί με τον υποκινητή του, μέσα σε γονίδιο ανθεκτικότητας.

    • B. 

      να συνδεθεί μετά από υποκινητή γονιδίου του πλασμιδίου, χωρίς τον υποκινητή του.

    • C. 

      να συνδεθεί σε οποιαδήποτε θέση του πλασμιδίου, χωρίς τον υποκινητή του.

    • D. 

      να συνδεθεί σε οποιαδήποτε θέση του πλασμιδίου, με τον υποκινητή του.

  • 25. 
    Σε cDNA βιβλιοθήκη σπληνικού κυττάρου υπάρχουν 85 κλώνοι με ανθρώπινο DNA. Αυτό σημαίνει ότι στο σπληνικό κύτταρο:
    • A. 

      μεταγράφονται 85 γονίδια.

    • B. 

      μεταγράφονται περισσότερα από 85 γονίδια.

    • C. 

      παράγονται 85 είδη πρωτεϊνών.

    • D. 

      παράγονται περισσότερα από 85 είδη πρωτεϊνών.