Επαναληπτικό τεστ στη βιολογία προσανατολισμού (1ο, 2ο, 4ο κεφάλαιο)

Approved & Edited by ProProfs Editorial Team
The editorial team at ProProfs Quizzes consists of a select group of subject experts, trivia writers, and quiz masters who have authored over 10,000 quizzes taken by more than 100 million users. This team includes our in-house seasoned quiz moderators and subject matter experts. Our editorial experts, spread across the world, are rigorously trained using our comprehensive guidelines to ensure that you receive the highest quality quizzes.
Learn about Our Editorial Process
| By Lena
L
Lena
Community Contributor
Quizzes Created: 1 | Total Attempts: 458
Questions: 25 | Attempts: 458

SettingsSettingsSettings
Επαναληπτικό τεστ στη βιολογία προσανατολισμού (1ο, 2ο, 4ο κεφάλαιο) - Quiz

.


Questions and Answers
  • 1. 

    Οι μεταγραφικοί παράγοντες αποτελούνται από:

    • A.

      ριβονουκλεοτίδια.

    • B.

      δεοξιριβονουκλεοτίδια.

    • C.

      αμινοξέα.

    • D.

      RNA συνδεδεμένο με πρωτεΐνες.

    Correct Answer
    C. αμινοξέα.
    Explanation
    Επειδή είναι πρωτεΐνες.

    Rate this question:

  • 2. 

    Σε ένα μόριο tRNA υπάρχει/-ουν:

    • A.

      5' και 3' αμετάφραστες περιοχές.

    • B.

      κωδικόνιο έναρξης.

    • C.

      κωδικόνιο λήξης.

    • D.

      προσανατολισμός 5' -> 3'.

    Correct Answer
    D. προσανατολισμός 5' -> 3'.
    Explanation
    Είναι ριβονουκλεοπρωτεϊνική αλυσίδα. Δεν μεταφράζεται όμως σε πρωτεΐνες.

    Rate this question:

  • 3. 

    Για την έκφραση των δομικών γονιδίων του οπερονίου της λακτόζης δεν είναι απαραίτητα:

    • A.

      τα ριβονουκλεοπρωτεϊνικά σωματίδια.

    • B.

      το σύμπλοκο έναρξης της μετάφρασης.

    • C.

      τα κωδικόνια λήξης.

    • D.

      το πολύσωμα.

    Correct Answer
    A. τα ριβονουκλεοπρωτεϊνικά σωματίδια.
    Explanation
    Πρόκειται για προκαρυωτικά γονίδια στα οποία δεν υπάρχουν εσώνια και δεν υφίστανται ωρίμανση.

    Rate this question:

  • 4. 

    Σε ένα πολύσωμα περιέχονται 5 ριβοσώματα. Αν το mRNA περιέχει 70 κωδικόνια, μεταξύ των 2 ριβοσωμάτων παρεμβάλλονται 10 κωδικόνια και το πρώτο ριβόσωμα βρίσκεται πάνω από το κωδικόνιο λήξης, πόσα αμινοξέα έχει προς το παρόν το πεπτίδιο που συνθέτει το τελευταίο ριβόσωμα (θεωρώντας ότι και οι 2 εισδοχές του είναι κατειλημμένες);

    • A.

      20

    • B.

      22

    • C.

      25

    • D.

      40

    Correct Answer
    B. 22
    Explanation
    Σε κάθε ριβόσωμα είναι κατειλημμένες και οι 2 εισδοχές, εκτός από το πρώτο στην 2η εισδοχή του οποίου μπαίνει ο παράγοντας απελευθέρωσης. Επομένως, 70-4x10-8, όπου 2x10 τα κωδικόνια μεταξύ των ριβοσωμάτων και 8 τα κωδικόνια πάνω στα οποία βρίσκονται τα ριβοσώματα.

    Rate this question:

  • 5. 

    Μπορεί να είναι γραμμικό:

    • A.

      πλασμίδιο

    • B.

      κύριο βακτηριακό μόριο DNA

    • C.

      μιτοχονδριακό DNA

    • D.

      χλωροπλαστικό DNA

    Correct Answer
    C. μιτοχονδριακό DNA
    Explanation
    Αν ανήκει σε κατώτερο πρωτόζωο.

    Rate this question:

  • 6. 

    Αν ο γαμέτης ανώτερου θηλαστικού έχει 32 μόρια DNA, πόσα μόρια DNA θα περιέχονται στον καρυότυπό του;

    • A.

      32

    • B.

      64

    • C.

      128

    • D.

      256

    Correct Answer
    C. 128
    Explanation
    Ο καρυότυπος κατασκευάζεται από σωματικά κύτταρα (διπλοειδή) στην μετάφαση, άρα τα χρωμοσώματα είναι διπλασιασμένα.

    Rate this question:

  • 7. 

    Το μόριο tRNA με αντικωδικόνιο 5'UGA3':

    • A.

      μεταφέρει το αμινοξύ thr.

    • B.

      μεταφέρει το αμινοξύ ser.

    • C.

      μεταφέρει το αμινοξύ met.

    • D.

      δεν μεταφέρει αμινοξύ.

    Correct Answer
    B. μεταφέρει το αμινοξύ ser.
    Explanation
    Γιατί είναι συμπληρωματικό κι αντιπαράλληλο του κωδικονίου 5'UCA3' του mRNA που κωδικοποιεί σερίνη.

    Rate this question:

  • 8. 

    Ο Οδυσσέας και ο Αντώνης έχουν ίδιο μιτοχονδριακό DNA και ίδια αλληλουχία βάσεων στο Υ χρωμόσωμά τους. Ο Οδυσσέας και ο Αντώνης είναι:

    • A.

      πατέρας και γιος.

    • B.

      αποκλειστικά μονοζυγωτικοί δίδυμοι.

    • C.

      πρώτα ξαδέρφια.

    • D.

      αμφιθαλή αδέρφια.

    Correct Answer
    D. αμφιθαλή αδέρφια.
    Explanation
    Λόγω του πανομοιότυπου μιτοχονδριακού DNA που είναι αποκλειστικά μητρικής προέλευσης.

    Rate this question:

  • 9. 

    Στο ώριμο mRNA δεν περιλαμβάνονται:

    • A.

      οι 5' και 3΄ αμετάφραστες περιοχές.

    • B.

      τα εξώνια.

    • C.

      ο υποκινητής.

    • D.

      το κωδικόνιο λήξης.

    Correct Answer
    C. ο υποκινητής.
    Explanation
    Είναι αλληλουχία πριν την αρχή του γονιδίου. Εκεί συνδέεται η RNApol για να ξεκινήσει τη μεταγραφή.

    Rate this question:

  • 10. 

    Τα αμινοξέα δεν αποτελούν συστατικά:

    • A.

      της EcoRI.

    • B.

      της DNA πολυμεράσης

    • C.

      της ινσουλίνης

    • D.

      ενός φορέα κλωνοποίησης

    Correct Answer
    D. ενός φορέα κλωνοποίησης
    Explanation
    Ο φορέας κλωνοποίησης είναι μόριο DNA (πλασμίδιο ή DNA φάγου) κι αποτελείται από δεοξυριβονουκλεοτίδια.

    Rate this question:

  • 11. 

    Σε μια θηλιά αντιγραφής σχηματίζονται 12 πρωταρχικά τμήματα. Τα ασυνεχή τμήματα σε κάθε αλυσίδα είναι:

    • A.

      11

    • B.

      6

    • C.

      5

    • D.

      4

    Correct Answer
    C. 5
    Explanation
    Η θηλιά χωρίζεται σε 2 διχάλες, άρα κάθε διχάλα θα έχει 6 πρωταρχικά τμήματα. Σε κάθε διχάλα, ένα πρωταρχικό τμήμα μπαίνει στην σύνθεση της συνεχούς αλυσίδας, οπότε τα υπόλοιπα 5 μπαίνουν στην σύνθεση της ασυνεχούς.

    Rate this question:

  • 12. 

    Σωστή απεικόνιση έναρξης της αντιγραφής ενός τμήματος DNA είναι:

    • A.

      5' GATATGGCACATTTAAATTTCGGAAC3' 3' CUAUAC->

    • B.

      5' GATATGGCACATTTAAATTTCGGAAC3'                                                 <-GCCTTG5'

    • C.

      5' GATATGGCACATTTAAATTTCGGAAC3' 3' CTATACC->

    • D.

      5' GATATGGCACATTTAAATTTCGGAAC3'                                               <-GCCUUG5'

    Correct Answer
    D. 5' GATATGGCACATTTAAATTTCGGAAC3'                                               <-GCCUUG5'
    Explanation
    Η αντιγραφή έχει προσανατολισμό 5' -> 3'. Στις ΘΕΑ συντίθενται πρωταρχικά τμήματα που είναι RNA τμήματα.

    Rate this question:

  • 13. 

    Η ακόλουθη αλληλουχία βάσεων αποτελεί κωδική αλυσίδα συνεχούς γονιδίου: 5' GCGCATGCCAACAATAGAGCGCATGAAAA3'  Το γονίδιο μεταγράφεται:

    • A.

      σε mRNA

    • B.

      σε tRNA

    • C.

      και μεταφράζεται σε πενταπεπτίδιο

    • D.

      και μεταφράζεται σε οπερόνιο

    Correct Answer
    B. σε tRNA
    Explanation
    Δεν εντοπίζονται από το 5 ' άκρο προς το 3' κωδικόνιο έναρξης και με βήμα τριπλέτας, κατά συνεχή και μη επικαλυπτόμενο τρόπο, κωδικόνιο λήξης, οπότε δεν αντιστοιχεί σε mRNA που μεταφράζεται σε αμινοξέα.

    Rate this question:

  • 14. 

    Κατά τη μεταγραφή ενός γονιδίου, η RNA πολυμεράση συνδέεται στον υποκινητή, προκαλεί τοπικό ξετύλιγμα και μεταγράφει την αλυσίδα που έχει:

    • A.

      3' άκρο στον υποκινητή

    • B.

      5' άκρο στον υποκινητή

    • C.

      κωδικόνιο έναρξης 5'ΑΤG3'

    • D.

      κωδικόνιο έναρξης 3'TAC5'

    Correct Answer
    A. 3' άκρο στον υποκινητή
    Explanation
    Η μεταγραφή γίνεται με προσανατολισμό 5' -> 3' και η RNApol αφού συνδεθεί στον υποκινητή, χρησιμοποιεί ως καλούπι την μεταγραφόμενη (μη κωδική) που θα έχει το 3' άκρο στον υποκινητή. Σε αυτήν δεν είναι απαραίτητο να υπάρχει κωδικόνιο έναρξης, αφού μπορεί να κωδικοποιεί τη σύνθεση tRNA ή rRNA μορίου.

    Rate this question:

  • 15. 

    Στο οπερόνιο της λακτόζης δεν υπάρχουν:

    • A.

      αλληλουχίες λήξης της μεταγραφής.

    • B.

      κωδικόνια λήξης.

    • C.

      ρυθμιστικές αλληλουχίες.

    • D.

      εσώνια.

    Correct Answer
    D. εσώνια.
    Explanation
    Πρόκειται για αλληλουχία βακτηρίου, ενώ ασυνεχή γονίδια έχουν μόνο οι ευκαρυωτικοί και οι ιοί που τους προσβάλλουν.

    Rate this question:

  • 16. 

    Ο παράγοντας VIII είναι μια πρωτεΐνη που συμβάλλει στην πήξη του αίματος και το γονίδιο που την κωδικοποιεί βρίσκεται στο χρωμόσωμα Χ. Ο υποκινητής του γονιδίου αυτού υπάρχει:

    • A.

      μόνο στα σωματικά κύτταρα ενός φυσιολογικού ατόμου.

    • B.

      σε όλα τα κύτταρα μιας φυσιολογικής γυναίκας.

    • C.

      σε όλα τα κύτταρα ενός φυσιολογικού άνδρα.

    • D.

      στα κύτταρα που επιτελούν την πήξη του αίματος.

    Correct Answer
    B. σε όλα τα κύτταρα μιας φυσιολογικής γυναίκας.
    Explanation
    Όλα τα κύτταρα ενός πολυκύτταρου ευκαρυωτικού οργανισμού έχουν το ίδιο DNA, οπότε θα περιέχουν τα ίδια γονίδια και τους υποκινητές τους. Απλά, τα διάφορα γονίδια θα εκφράζονται σε διαφορετικούς ιστούς. Στον φυσιολογικό άντρα δεν μπορούν όλα τα κύτταρα να περιέχουν τον εν λόγω υποκινητή, καθώς κάποια σπερματοζωάρια διαθέτουν μόνο το Υ κι όχι το Χ χρωμόσωμα.

    Rate this question:

  • 17. 

    Σε θρεπτικό υλικό γλυκόζης, στέλεχος E.coli παράγει ποσότητες των τριών ενζύμων που διασπούν τη λακτόζη. Αυτό μπορεί να οφείλεται σε μετάλλαξη:

    • A.

      στον υποκινητή των τριών δομικών γονιδίων.

    • B.

      στην πρωτεΐνη καταστολέα ώστε αυτή να μην συνδέεται με την λακτόζη.

    • C.

      στο ρυθμιστικό γονίδιο, που το κατέστησε ανενεργό.

    • D.

      στα δομικά γονίδια.

    Correct Answer
    C. στο ρυθμιστικό γονίδιο, που το κατέστησε ανενεργό.
    Explanation
    Σαν αποτέλεσμα, δεν συντίθεται ο καταστολέας, οπότε δεν γίνεται σύνδεση στον χειριστή. Η RNApol συνδέεται στον υποκινητή και μεταγράφει ανεμπόδιστα τα δομικά γονίδια, παράγοντας τα ένζυμα διάσπασης λακτόζης, που όμως δεν είναι απαραίτητα στο δεδομένο θρεπτικό.

    Rate this question:

  • 18. 

    Ο χειριστής του οπερονίου της λακτόζης δεν περιέχει:

    • A.

      άζωτο

    • B.

      θείο

    • C.

      άνθρακα

    • D.

      φώσφορο

    Correct Answer
    B. θείο
    Explanation
    Καθώς είναι DNA αλληλουχία, ενώ θείο περιέχεται αποκλειστικά στις πρωτεΐνες.

    Rate this question:

  • 19. 

    Η μεταγραφή του γονιδίου μιας πρωτεΐνης Α απαιτεί τους μεταγραφικούς παράγοντες Χ και Υ. Η πρωτεΐνη παράγεται αποκλειστικά σε ανθρώπινα ηπατικά και νευρικά κύτταρα. Αυτό συμβαίνει διότι:

    • A.

      τα ηπατικά και τα νεφρικά κύτταρα έχουν ίδιους μεταγραφικούς παράγοντες.

    • B.

      τα ηπατικά και τα νεφρικά κύτταρα έχουν ίδιους υποκινητές.

    • C.

      οι υπόλοιποι κυτταρικοί τύποι του οργανισμού δεν έχουν τον μεταγραφικό παράγοντα Χ ή τον Υ ή και τους δύο.

    • D.

      οι υπόλοιποι κυτταρικοί τύποι του οργανισμού δεν έχουν τον υποκινητή του γονιδίου της πρωτεΐνης Α.

    Correct Answer
    C. οι υπόλοιποι κυτταρικοί τύποι του οργανισμού δεν έχουν τον μεταγραφικό παράγοντα Χ ή τον Υ ή και τους δύο.
    Explanation
    Όλα τα κύτταρα ενός ανώτερου πολυκύτταρου ευκαρυωτικού οργανισμού έχουν το ίδιο DNA, αλλά εκφράζουν διαφορετικά γονίδια, εξαιτίας της ποικιλίας μεταγραφικών παραγόντων που διαθέτουν. Μόνο ο κατάλληλος συνδυασμός μεταγραφικών παραγόντων μπορεί να οδηγήσει στην μεταγραφή ενός γονιδίου. Αν απουσιάζει ένας ή περισσότεροι από αυτούς από το κύτταρο, η έκφραση του γονιδίου δεν επιτελείται.

    Rate this question:

  • 20. 

    Σε cDNA βιβλιοθήκη τόσο του παγκρεατικού όσο και του πρόδρομου ερυθροκυττάρου ενός οργανισμού μπορεί να είναι κοινός ο κλώνος του γονιδίου για:

    • A.

      το tRNA της μεθειονίνης.

    • B.

      το rRNA.

    • C.

      την πρωτεΐνη του ριβοσώματος.

    • D.

      την ινσουλίνη.

    Correct Answer
    C. την πρωτεΐνη του ριβοσώματος.
    Explanation
    Η cDNA βιβλιοθήκη κατασκευάζεται από το ολικό ώριμο mRNA που παράγεται σε έναν συγκεκριμένο κυτταρικό τύπο. Άρα δεν περιέχει tRNA ή rRNA γονίδια,καθώς και γονίδια άλλων κυτταρικών τύπων.

    Rate this question:

  • 21. 

    Η περιοριστική ενδονουκλεάση BamHI αναγνωρίζει  9000 θέσεις στο πυρηνικό DNA ενός σωματικού κυττάρου της γυναίκας. Μετά την επίδρασή της στο πυρηνικό DNA, ο αριθμός των θραυσμάτων που προκύπτουν είναι:

    • A.

      9001

    • B.

      9023

    • C.

      9046

    • D.

      περισσότερα από 9046

    Correct Answer
    C. 9046
    Explanation
    Το πυρηνικό DNA μιας γυναίκας αποτελείται από 46 γραμμικά μόρια DNA. Σε κάθε ένα γραμμικό μόριο αν η ενδονουκλεάση κόβει x φορές, τα θραύσματα που θα προκύψουν θα είναι x+1, οπότε στα 46 μόρια, επειδή η ενδονουκλεάση κόβει 9000 φορές, θα είναι 9046.

    Rate this question:

  • 22. 

    Η περιοριστική ενδονουκλεάση DdeI αναγνωρίζει 4000 θέσεις στο πυρηνικό DNA ενός ωαρίου γυναίκας, Μετά την επίδραση στο συνολικό DNA του ωαρίου, ο αριθμός των θραυσμάτων που προκύπτουν είναι:

    • A.

      4001

    • B.

      4023

    • C.

      περισσότερα από 4023

    • D.

      λιγότερα από 4023

    Correct Answer
    C. περισσότερα από 4023
    Explanation
    Στο συνολικό DNA του ωαρίου, εκτός από τα 23 γραμμικά χρωμοσώματα, περιέχεται και το μιτοχονδριακό DNA.

    Rate this question:

  • 23. 

    ΟΙ 5' και 3' αμετάφρασες περιοχές ενός γονιδίου είναι δυνατόν να κλωνοποιηθούν:

    • A.

      σε γονιδιωματική βιβλιοθήκη.

    • B.

      σε cDNA βιβλιοθήκη.

    • C.

      και με τις 2 βιβλιοθήκες.

    • D.

      αποκλειστικά με PCR.

    Correct Answer
    C. και με τις 2 βιβλιοθήκες.
    Explanation
    Είναι μέρος του ώριμου mRNA και φυσικά του συνολικού γονιδιώματος.

    Rate this question:

  • 24. 

    Γονίδιο βατράχου μεταφέρεται σε πλασμίδιο και το ανασυνδυασμένο πλασμίδιο μετασχηματίζει βακτήριο προκειμένου να παραχθεί σε αυτό η πρωτεΐνη του βατράχου. Το γονίδιο πρέπει:

    • A.

      να μεταφερθεί με τον υποκινητή του, μέσα σε γονίδιο ανθεκτικότητας.

    • B.

      να συνδεθεί μετά από υποκινητή γονιδίου του πλασμιδίου, χωρίς τον υποκινητή του.

    • C.

      να συνδεθεί σε οποιαδήποτε θέση του πλασμιδίου, χωρίς τον υποκινητή του.

    • D.

      να συνδεθεί σε οποιαδήποτε θέση του πλασμιδίου, με τον υποκινητή του.

    Correct Answer
    B. να συνδεθεί μετά από υποκινητή γονιδίου του πλασμιδίου, χωρίς τον υποκινητή του.
    Explanation
    Τα βακτηριακά κύτταρα έχουν διαφορετικούς μεταγραφικούς παράγοντες από τα ευκαρυωτικά, οπότε για να εκφραστεί το γονίδιο πρέπει να εισαχθεί μετά από υποκινητή για τον οποίο το κύτταρο-ξενιστής (που είναι βακτήριο) θα διαθέτει τους κατάλληλους μεταγραφικούς παράγοντες.

    Rate this question:

  • 25. 

    Σε cDNA βιβλιοθήκη σπληνικού κυττάρου υπάρχουν 85 κλώνοι με ανθρώπινο DNA. Αυτό σημαίνει ότι στο σπληνικό κύτταρο:

    • A.

      μεταγράφονται 85 γονίδια.

    • B.

      μεταγράφονται περισσότερα από 85 γονίδια.

    • C.

      παράγονται 85 είδη πρωτεϊνών.

    • D.

      παράγονται περισσότερα από 85 είδη πρωτεϊνών.

    Correct Answer
    B. μεταγράφονται περισσότερα από 85 γονίδια.
    Explanation
    Οι κλώνοι της cDNA βιβλιοθήκης περιέχουν γονίδια που εκφράζονται στον συγκεκριμένο κυτταρικό τύπο. Άρα το σπληνικό κύτταρο μεταγράφει 85 γονίδια που μεταφράζονται σε 85 πολυπεπτιδικές αλυσίδες. Αυτές συνδυάζονται και δίνουν πρωτεΐνες. Επίσης,θα μεταγράφει και γονίδια tRNA και rRNA, που δεν αντιπροσωπεύονται σε αυτό το είδος βιβλιοθήκης.

    Rate this question:

Quiz Review Timeline +

Our quizzes are rigorously reviewed, monitored and continuously updated by our expert board to maintain accuracy, relevance, and timeliness.

  • Current Version
  • Mar 20, 2023
    Quiz Edited by
    ProProfs Editorial Team
  • Sep 26, 2018
    Quiz Created by
    Lena
Back to Top Back to top
Advertisement
×

Wait!
Here's an interesting quiz for you.

We have other quizzes matching your interest.