Examen Dogma Central De LA BiologÍa

The correct answer is ADN → ARN → proteínas. This sequence represents the central dogma of molecular biology, which states that genetic information flows from DNA to RNA to proteins. DNA contains the instructions for building proteins, but it cannot directly participate in protein synthesis. Instead, the information is transcribed from DNA to RNA through a process called transcription. The RNA then serves as a template for protein synthesis during translation. Therefore, the correct sequence is DNA to RNA to proteins.

The process described in the question, where two identical double helices of DNA are formed from one DNA molecule, is called replication.

Cuando decimos que un gen se expresa, nos referimos a que la información contenida en ese gen es transcrita y traducida en una proteína. La transcripción es el proceso mediante el cual se copia la secuencia de ADN del gen en una molécula de ARN mensajero (ARNm). Luego, la traducción ocurre cuando el ARNm se une a los ribosomas y se utiliza como molde para sintetizar una cadena de aminoácidos, que se pliega y forma una proteína funcional. Por lo tanto, la expresión de un gen implica la producción de una proteína a partir de la información genética.

The sequence "CCGUA" does not correspond to DNA because it contains the base "U" which is uracil. Uracil is found in RNA, not DNA. DNA is composed of the bases adenine (A), cytosine (C), guanine (G), and thymine (T). Therefore, "CCGUA" is not a valid DNA sequence.

Each amino acid in a protein is coded by a codon, which is made up of a group of three nucleotides. This is because there are 20 different amino acids that need to be coded for, and using a group of three nucleotides allows for 64 different combinations, which is more than enough to code for all the different amino acids. Additionally, using a group of three nucleotides provides redundancy and helps to prevent errors during the translation process.

The given DNA sequence is "mtacaatcatgcgctatgagtcggcaggaatcagtacgcttccatc". To determine the corresponding RNA sequence, we need to replace each occurrence of "t" with "u" (since RNA uses uracil instead of thymine). Therefore, the RNA sequence is "muaacaacaugcgcuaugagucggcaggaaucaguacgcuuccauc". The correct answer is "auguuaguacgcgauacucagccguccuuagucaugcgaagguag".

La ribosa y la desoxirribosa son azúcares que forman parte de los nucleótidos. La ribosa se encuentra en los nucleótidos del ARN, mientras que la desoxirribosa se encuentra en los nucleótidos del ADN. Por lo tanto, la respuesta correcta es "El ARN y en el ADN respectivamente".

The size of a protein is determined by the number of amino acids it contains. In this case, the protein has 100 amino acids. Each amino acid is coded by a specific sequence of three nucleotides (codons) in the mRNA molecule. Therefore, to determine the number of nucleotides in the mRNA fragment that codes for this protein, we need to multiply the number of amino acids by 3. 100 amino acids x 3 nucleotides per amino acid = 300 nucleotides. Therefore, the correct answer is 300.

The statement is false because the start codon of a protein is always AUG, which codes for methionine, not arginine. Arginine is encoded by the codons AGA and AGG.

The correct answer is "Núcleo". This is because the nucleus is a defining feature of eukaryotic cells, which are cells that have a membrane-bound nucleus. Prokaryotic cells, on the other hand, do not have a nucleus. They have their DNA floating freely in the cytoplasm. Therefore, the absence of a nucleus is a characteristic feature of prokaryotic cells.

The correct answer is "Ribosa-una base nitrogenada (A,G,C,U)-fosfato". This is because the nucleotide unit of RNA is composed of ribose sugar, a nitrogenous base (adenine, guanine, cytosine, or uracil), and a phosphate group. The given answer includes all the correct components of an RNA nucleotide.

Fosfolípidos forman parte esencial de las membranas celulares. Estas moléculas tienen una estructura con una cabeza hidrofílica y una cola hidrofóbica, lo que les permite formar una bicapa lipídica que constituye la base de las membranas celulares. Los fosfolípidos son fundamentales para mantener la integridad y la función de las membranas, ya que controlan el paso de sustancias y protegen el interior de la célula. El colágeno y la celulosa son moléculas estructurales que se encuentran en otros tejidos, mientras que los ácidos nucleicos están relacionados con la información genética y no forman parte directa de las membranas celulares.

The explanation for the given correct answer is that exons are DNA sequences that contain the coding information for a protein, while introns are non-coding sequences that do not contribute to protein synthesis. Exons are transcribed into messenger RNA (mRNA) and are eventually translated into proteins, while introns are removed during mRNA processing. Therefore, it is true that exons are coding sequences, while introns are regulatory sequences.

The correct answer is True. The CAP of messenger RNA (mRNA) is a methylated guanosine. The CAP is a modified nucleotide structure that is added to the 5' end of mRNA during transcription. It helps protect the mRNA from degradation and plays a crucial role in the initiation of translation. Methylation of the guanosine residue at the CAP provides stability to the mRNA molecule and is involved in various cellular processes, including mRNA splicing and export from the nucleus.

La cromatina está constituida por la asociación de ADN y proteínas histonas formando los nucleosomas. La cromatina es la forma en la que el ADN se organiza en el núcleo de las células eucariotas. Las histonas son proteínas que se unen al ADN y ayudan a compactarlo en una estructura llamada nucleosoma. Estos nucleosomas se agrupan y forman la cromatina, que es visible durante la división celular y contiene toda la información genética de la célula.

In this question, the correct answer is that the sex chromosomes are the same in women but not in men. This is because women have two X chromosomes (XX), while men have one X and one Y chromosome (XY). The autosomes, on the other hand, are the same in both men and women.

The correct answer is False because the complementary nitrogenous bases in DNA are A-T and G-C. A pairs with T and G pairs with C.

Durante la transcripción de un gen, un error en un nucleótido puede tener varias consecuencias. Puede alterar la secuencia de una proteína, ya que la secuencia de aminoácidos en una proteína está determinada por la secuencia de nucleótidos en el ARNm. También puede alterar la secuencia de nucleótidos del ARNm en sí mismo. Si este error persiste en la célula, puede dar lugar a una mutación, que es un cambio permanente en la secuencia de ADN. Por lo tanto, todas las respuestas anteriores son correctas, ya que todas describen posibles consecuencias de un error en un nucleótido durante la transcripción.

The correct answer is "Estructura primaria de la proteína". This is because the sequence of amino acids in a protein, which is determined by the genetic information contained in DNA, is referred to as the primary structure of the protein. It is the most basic level of protein structure and plays a crucial role in determining its overall shape and function. The other options mentioned, such as α-helix structure and active center, are different levels or components of protein structure and function.

En el ADN, la secuencia de nucleótidos que constituye una unidad de información genética en la síntesis de una proteína se denomina "gen". Un gen es una secuencia específica de ADN que contiene la información necesaria para la síntesis de una proteína en el proceso de transcripción y traducción. Los genes son la unidad básica de la herencia y determinan las características y funciones de los organismos. El ADN se organiza en estructuras más grandes llamadas cromosomas, pero un gen es una sección específica de ADN que contiene la información para una proteína en particular. El ARN mensajero es el intermediario entre el ADN y la síntesis de proteínas, y el genoma es el conjunto completo de genes en un organismo.

The correct answer is "Síntesis de proteínas por el ribosoma" because translation is the process by which a ribosome synthesizes proteins using the information encoded in mRNA. This process takes place in the cytoplasm, where the ribosomes are located. mRNA is transcribed in the nucleus and then transported to the cytoplasm for translation to occur. Therefore, the correct answer is that protein synthesis occurs in the cytoplasm by the ribosome.

The addition of carbohydrates to proteins, also known as glycosylation, occurs in the Golgi apparatus. The Golgi apparatus is responsible for modifying, sorting, and packaging proteins before they are transported to their final destinations within the cell or outside of it. In the Golgi apparatus, enzymes add carbohydrate molecules to specific sites on the protein, resulting in the formation of glycoproteins. This process is essential for the proper functioning of proteins and plays a crucial role in cell-cell recognition, protein folding, and stability.

La replicación es un proceso en el cual una cadena de ADN se copia a otra cadena de ARN. Durante la replicación, la enzima llamada ARN polimerasa sintetiza una cadena complementaria de ARN utilizando la cadena de ADN como plantilla. Este proceso es esencial para la síntesis de proteínas y la transmisión de información genética.

Tienes que colocar las primeras tres iniciales del aminoácido (en ingles) separadas por un guión.