We have sent an email with your new password.


Genetics Final Exam

100 Questions  I  By ProfGentle
  • Share This on Twitter
  • +
Genetics Quizzes & Trivia
This is a Cumulative Exam focusing on Genetics

  
Changes are done, please start the quiz.


Question Excerpt

Removing question excerpt is a premium feature

Upgrade and get a lot more done!
1.  Nonsense mutations do not alter DNA sequence information.
A.
B.
2.  A eukaryotic promoter contains a Pribnow box
A.
B.
3.  The primary structure of a protein is determined by
A.
B.
C.
D.
E.
4.  Homologous genes found in different species that evolved from a common ancestor are called?
A.
B.
C.
D.
E.
5.  Before a prokaryotic mRNA can be translated, it must be modified by the 
A.
B.
C.
D.
E.
6.  The presence of a single mutated gene is sufficient for retinoblastoma cancer to develop
A.
B.
7.  The chromosome theory of inheritance states that 
A.
B.
C.
D.
E.
8.  The ratio of (A+T) to (G+C) in a double-stranded DNA molecule is equal to 1
A.
B.
9.                  opens the double helix for replication machinery.
A.
B.
C.
D.
E.
10.     ??       speciation is initiated by a geographic barrier to gene flow
A.
B.
C.
D.
E.
11.  ) If purple (P) is dominant to white (p) and axial (A) is dominant to terminal (a), and in a cross of white, axial to purple, axial the ratio of offspring is   6/16 white, axial;       2/16 white, terminal;       6/16 purple, axial;       2/16 purple, terminal,                                     What is the genotype of the parents?
A.
B.
C.
D.
E.
12.  The recombination frequency between three genes can be used to calculate
A.
B.
C.
D.
E.
13.  An individual heterozygous for d e f was crossed to a homozygous recessive individual (d/d e/e f/f).  The following offspring were recovered. +  +  +             39 +  e  f               372 d  +  f               7 d  e  f               47 +  e  +              5 d  +  +              412  What is the correct order of these genes?
A.
B.
C.
14.  All RNAs are translated.
A.
B.
15.  In a double-stranded RNA molecule of 10,000 base pairs, the approximate number of complete turns is?
A.
B.
C.
D.
E.
16.  Given the following sequence, how large (# amino acids) is the most likely eukaryotic polypeptide produced?                                       ACGAUGAGGAGGAUGGUCAAUGAUGCUGGCUGUUGAUAUUAACAU
A.
B.
C.
D.
E.
17.  G and U are present in both DNA and RNA
A.
B.
18.  Bacterial Recombination requires?
A.
B.
C.
D.
E.
19.  In human males, genes on the X chromosome are
A.
B.
C.
D.
E.
20.      ??      speciation arises in the absence of any geographic barrier to gene flow:
A.
B.
C.
D.
E.
21.  Messenger RNA is usually polycistronic in eukaryotes
A.
B.
22.  The two major components of Tobacco Mosaic Virus are?
A.
B.
C.
D.
E.
23.  The basic structure of nucleotide includes the following components
A.
B.
C.
D.
E.
24.  Which event is not normally associated with development of cancer?
A.
B.
C.
D.
E.
25.  Introns are removed from precursor mRNAs by spliceosomes
A.
B.
26.  The mating system in E.coli is known as?
A.
B.
C.
D.
E.
27.  Given the sequence 5’-AGTTACCTGA-3’ what would be the sequence of the complementary DNA strand?
A.
B.
C.
D.
E.
28.  Frameshift mutations generally have more drastic effects on the phenotype than do substitutions.
A.
B.
29.  For most protein-encoding genes, the synonymous rate of change is:
A.
B.
C.
D.
E.
30.  Enzyme that charges tRNAs
A.
B.
C.
D.
31.  What is the name for the statistical measure used to describe sample variability
A.
B.
C.
D.
E.
32.  Proto-oncogenes are found in normal, non-cancerous cells and are responsible for normal cell processes.
A.
B.
33.  A Barr body is an
A.
B.
C.
D.
34.                 actually synthesizes RNA, not DNA. 
A.
B.
C.
D.
E.
35.  Enzyme involved in transcription of mRNA
A.
B.
C.
D.
36.  That some organisms contain much larger amounts of DNA than apparently "needed" and that some relatively closely related organisms may have vastly different amounts of DNA is more typical in
A.
B.
C.
D.
E.
37.  During replication, primase adds an RNA primer to DNA.
A.
B.
38.  A person who is known to have a particular genotype does not show the phenotype specified by the gene. This is an example of 
A.
B.
C.
D.
E.
39.  A wingless fruit fly is isolated from a population after exposure of the parental generation to EMS.  Eventually the mutation is shown to have occurred within the coding sequence of a gene that changes a 5’-GGC-3’ codon (encoding glycine) to a 5’-AGC-3’ codon (encoding serine).  Which term would not correctly describe this mutation?
A.
B.
C.
D.
E.
40.  Which of the following statements is true:
A.
B.
C.
D.
E.
41.  The genetic material of eukaryotic cells is duplicated during which stage of cell cycle?
A.
B.
C.
D.
E.
42.  Homologous genes in the same organism are called?
A.
B.
C.
D.
E.
43.  In a pea plant that is heterozygous for seed color, what proportion of gametes will carry the recessive allele?
A.
B.
C.
D.
E.
44.  DNA-dependent DNA polymerase
A.
B.
C.
D.
45.  Enzyme involved in transcription of tRNA
A.
B.
C.
D.
46.  Which of the following is most likely to cause a frameshift mutation?
A.
B.
C.
D.
E.
47.  In lilies, white flowers (W) are dominant to purple flowers (w).  If two plants that are heterozygous for flower color are mated, the offspring might have which genotype? 
A.
B.
C.
D.
E.
48.  Crossing over occurs most frequently during which stage of cell division? 
A.
B.
C.
D.
E.
49.  ________ results when chromatids fail to separate and move to opposite poles during anaphase. 
A.
B.
C.
D.
E.
50.  The term used to describe genes that are evolutionarily related is?
A.
B.
C.
D.
E.
51.  Chromatin contains
A.
B.
C.
D.
E.
52.  Regulation of the lac operon of E. coli by lactose is both negative and inducible
A.
B.
53.  A(n)                  gene masks the expression of a different, nonallelic gene.
A.
B.
C.
D.
E.
54.  Proto-oncogenes cause cancer.
A.
B.
55.  In catabolite repression of the lac operon, glucose affects most directly the
A.
B.
C.
D.
E.
56.  If the percentage of uracil in a double-stranded RNA molecule is 30%, the percentage of cytosine is?
A.
B.
C.
D.
E.
57.  Phosphorylation of pRB is carried out by?
A.
B.
C.
D.
E.
58.  The appearance of traits expressed by genes in association with environmental influence is referred to as the organism's 
A.
B.
C.
D.
E.
59.  Mendel crossed purebred wrinkled, green-seeded plants with purebred round, yellow-seeded plants.  Round seeds are recessive to wrinkled, and yellow seeds are recessive to green. The F1 progeny were self-crossed.  Which of the following numbers are most likely to result from this cross.
A.
B.
C.
D.
E.
60.  When one speaks of a 5' cap, one is usually describing?
A.
B.
C.
D.
E.
61.  Assume that a cross is made between tall and dwarf tobacco plants.  The F1 generation showed intermediate height, while the F2 generation showed a distribution of height ranging from tall to dwarf, like the original parents, and many heights between the extremes.  These data are consistent with the following mode of inheritance:
A.
B.
C.
D.
E.
62.  For any gene with multiple alleles, a diploid organism may have a maximum of ________ alleles for that locus.
A.
B.
C.
D.
E.
63.  Which of the following statements about an animal bearing a somatic mutation is true?
A.
B.
C.
D.
E.
64.  Which of the following enzymes initiate chain synthesis on a template during replication? 
A.
B.
C.
D.
E.
65.  Typically, a small subset of genes are expressed in each type of cell within an organism.
A.
B.
66.  Plasmids that can confer the ability to conjugate are known as?
A.
B.
C.
D.
E.
67.  Chromosomal inversions result in duplications and deletions
A.
B.
68.  In the absence of tryptophan, the genes of the trp operon are not expressed.
A.
B.
69.  The transfer of bacterial genes from one cell to another requires?
A.
B.
C.
D.
E.
70.  DNA synthesis in eukaryotes is?
A.
B.
C.
D.
E.
71.  At the conclusion of meiosis, there are ________ cells
A.
B.
C.
D.
72.  Which of the following is a nonhistone protein found in chromatin? 
A.
B.
C.
D.
73.  The sugar ribose differs from deoxyribose by an OH group at the 5' C position 
A.
B.
74.  A man with blood type A and a woman with blood type B could never produce a child with blood type
A.
B.
C.
D.
E.
75.  Which of the following codon pairs specify amino acids
A.
B.
C.
D.
76.  In the absence of glucose, the CAP protein binds to a DNA sequence adjacent to the promoter of the lac operon.  Binding of CAP helps RNA polymerase to bind to the promoter and allows for a high level of transcription of the lac operon.  Regulation of the lac operon by the CAP protein is an example of
A.
B.
C.
D.
E.
77.  If the sequence of an RNA molecule is 5’-GGCAUCGACG-3’, what is the sequence of the template strand of DNA?
A.
B.
C.
D.
E.
78.  The ratio of (A+G) to (T+C) in a double-stranded DNA molecule is equal to 1
A.
B.
79.                   contains an RNA molecule which is required for function.
A.
B.
C.
D.
E.
80.  Which element of the lac operon can act in cis or trans?
A.
B.
C.
D.
E.
81.  Most genes in prokaryotes and eukaryotes are regulated primarily at which level of expression?
A.
B.
C.
D.
E.
82.                  removes RNA primer.
A.
B.
C.
D.
E.
83.  The genetic code is said to be “degenerate” because 
A.
B.
C.
D.
84.  The codon for methionine appears only at the beginning of the mRNA for a protein, not in the middle or in the end.
A.
B.
85.  Given an inheritance pattern of incomplete dominance and 81 flowers are red (R1R1), 18 flowers are pink (R1R2), and 1 flower is white (R2R2), the frequency of the R1 allele is 0.9.
A.
B.
86.  If the sequence of a nontemplate strand of DNA is 5’-ACCGCATCCGAGTCAC-3’, what is the sequence of the primary product of transcription?
A.
B.
C.
D.
E.
87.  A purine’s being replaced by a different purine is called a transition mutation.
A.
B.
88.  Which of the following is not different between eukaryotic and prokaryotic transcription?
A.
B.
C.
D.
E.
89.  In an interacting gene pair, the gene whose expression is masked by another gene is the         gene.
A.
B.
C.
D.
E.
90.  In the absence of allolactose, the lac operon is constitutively transcribed.
A.
B.
91.  An organism's complete set of genes is called its 
A.
B.
C.
D.
E.
92.                  relieves torsional stress.
A.
B.
C.
D.
E.
93.  For a species with a diploid number of 18 chromosomes, how many chromosomes will be present in the somatic nuclei of individuals that are tetraploid?
A.
B.
C.
D.
E.
94.  Which of the following groups of proteins is NOT commonly known to include oncogenes?
A.
B.
C.
D.
E.
95.  The phenomenon of crossovers in nearby regions is called
A.
B.
C.
D.
E.
96.  The correct order of activity in replication is
A.
B.
C.
D.
E.
97.  Which of the following must exist within a population before evolution can take place?
A.
B.
C.
D.
E.
98.  Hershey and Chase differentiated between DNA and protein by:
A.
B.
C.
D.
E.
99.  Proteins are composed of strings of nucleotides connected together by 5' - 3' phosphodiester bonds.
A.
B.
100.  An allopolyploid consists of more than 2 haploid sets of chromosomes, originating from the same species.
A.
B.
Back to top

Removing ad is a premium feature

Upgrade and get a lot more done!
Take Another Quiz