Genetics Final Exam

100 Questions  I  By ProfGentle
This is a Cumulative Exam focusing on Genetics

  
Changes are done, please start the quiz.


Question Excerpt

Removing question excerpt is a premium feature

Upgrade and get a lot more done!
1.  A eukaryotic promoter contains a Pribnow box
A.
B.
2.  The chromosome theory of inheritance states that 
A.
B.
C.
D.
E.
3.  Enzyme involved in transcription of tRNA
A.
B.
C.
D.
4.  The two major components of Tobacco Mosaic Virus are?
A.
B.
C.
D.
E.
5.  Plasmids that can confer the ability to conjugate are known as?
A.
B.
C.
D.
E.
6.                  opens the double helix for replication machinery.
A.
B.
C.
D.
E.
7.  The recombination frequency between three genes can be used to calculate
A.
B.
C.
D.
E.
8.  DNA-dependent DNA polymerase
A.
B.
C.
D.
9.  For any gene with multiple alleles, a diploid organism may have a maximum of ________ alleles for that locus.
A.
B.
C.
D.
E.
10.  G and U are present in both DNA and RNA
A.
B.
11.  Typically, a small subset of genes are expressed in each type of cell within an organism.
A.
B.
12.  In the absence of tryptophan, the genes of the trp operon are not expressed.
A.
B.
13.  A wingless fruit fly is isolated from a population after exposure of the parental generation to EMS.  Eventually the mutation is shown to have occurred within the coding sequence of a gene that changes a 5’-GGC-3’ codon (encoding glycine) to a 5’-AGC-3’ codon (encoding serine).  Which term would not correctly describe this mutation?
A.
B.
C.
D.
E.
14.  Enzyme that charges tRNAs
A.
B.
C.
D.
15.  Which of the following must exist within a population before evolution can take place?
A.
B.
C.
D.
E.
16.  In the absence of allolactose, the lac operon is constitutively transcribed.
A.
B.
17.  Introns are removed from precursor mRNAs by spliceosomes
A.
B.
18.  The ratio of (A+T) to (G+C) in a double-stranded DNA molecule is equal to 1
A.
B.
19.                  removes RNA primer.
A.
B.
C.
D.
E.
20.  The sugar ribose differs from deoxyribose by an OH group at the 5' C position 
A.
B.
21.  ________ results when chromatids fail to separate and move to opposite poles during anaphase. 
A.
B.
C.
D.
E.
22.  A purine’s being replaced by a different purine is called a transition mutation.
A.
B.
23.  When one speaks of a 5' cap, one is usually describing?
A.
B.
C.
D.
E.
24.  In a pea plant that is heterozygous for seed color, what proportion of gametes will carry the recessive allele?
A.
B.
C.
D.
E.
25.  A man with blood type A and a woman with blood type B could never produce a child with blood type
A.
B.
C.
D.
E.
26.  If the sequence of a nontemplate strand of DNA is 5’-ACCGCATCCGAGTCAC-3’, what is the sequence of the primary product of transcription?
A.
B.
C.
D.
E.
27.  The appearance of traits expressed by genes in association with environmental influence is referred to as the organism's 
A.
B.
C.
D.
E.
28.  Messenger RNA is usually polycistronic in eukaryotes
A.
B.
29.  An allopolyploid consists of more than 2 haploid sets of chromosomes, originating from the same species.
A.
B.
30.  The presence of a single mutated gene is sufficient for retinoblastoma cancer to develop
A.
B.
31.  Which of the following is a nonhistone protein found in chromatin? 
A.
B.
C.
D.
32.  Given the sequence 5’-AGTTACCTGA-3’ what would be the sequence of the complementary DNA strand?
A.
B.
C.
D.
E.
33.  All RNAs are translated.
A.
B.
34.  Nonsense mutations do not alter DNA sequence information.
A.
B.
35.  The mating system in E.coli is known as?
A.
B.
C.
D.
E.
36.  Assume that a cross is made between tall and dwarf tobacco plants.  The F1 generation showed intermediate height, while the F2 generation showed a distribution of height ranging from tall to dwarf, like the original parents, and many heights between the extremes.  These data are consistent with the following mode of inheritance:
A.
B.
C.
D.
E.
37.     ??       speciation is initiated by a geographic barrier to gene flow
A.
B.
C.
D.
E.
38.                  relieves torsional stress.
A.
B.
C.
D.
E.
39.  At the conclusion of meiosis, there are ________ cells
A.
B.
C.
D.
40.  Mendel crossed purebred wrinkled, green-seeded plants with purebred round, yellow-seeded plants.  Round seeds are recessive to wrinkled, and yellow seeds are recessive to green. The F1 progeny were self-crossed.  Which of the following numbers are most likely to result from this cross.
A.
B.
C.
D.
E.
41.  DNA synthesis in eukaryotes is?
A.
B.
C.
D.
E.
42.  Enzyme involved in transcription of mRNA
A.
B.
C.
D.
43.  In human males, genes on the X chromosome are
A.
B.
C.
D.
E.
44.  What is the name for the statistical measure used to describe sample variability
A.
B.
C.
D.
E.
45.  In an interacting gene pair, the gene whose expression is masked by another gene is the         gene.
A.
B.
C.
D.
E.
46.  In the absence of glucose, the CAP protein binds to a DNA sequence adjacent to the promoter of the lac operon.  Binding of CAP helps RNA polymerase to bind to the promoter and allows for a high level of transcription of the lac operon.  Regulation of the lac operon by the CAP protein is an example of
A.
B.
C.
D.
E.
47.  An individual heterozygous for d e f was crossed to a homozygous recessive individual (d/d e/e f/f).  The following offspring were recovered. +  +  +             39 +  e  f               372 d  +  f               7 d  e  f               47 +  e  +              5 d  +  +              412  What is the correct order of these genes?
A.
B.
C.
48.  For most protein-encoding genes, the synonymous rate of change is:
A.
B.
C.
D.
E.
49.  Which of the following enzymes initiate chain synthesis on a template during replication? 
A.
B.
C.
D.
E.
50.  A(n)                  gene masks the expression of a different, nonallelic gene.
A.
B.
C.
D.
E.
51.  Which of the following codon pairs specify amino acids
A.
B.
C.
D.
52.  Which element of the lac operon can act in cis or trans?
A.
B.
C.
D.
E.
53.  A person who is known to have a particular genotype does not show the phenotype specified by the gene. This is an example of 
A.
B.
C.
D.
E.
54.  Given the following sequence, how large (# amino acids) is the most likely eukaryotic polypeptide produced?                                       ACGAUGAGGAGGAUGGUCAAUGAUGCUGGCUGUUGAUAUUAACAU
A.
B.
C.
D.
E.
55.      ??      speciation arises in the absence of any geographic barrier to gene flow:
A.
B.
C.
D.
E.
56.  Before a prokaryotic mRNA can be translated, it must be modified by the 
A.
B.
C.
D.
E.
57.                 actually synthesizes RNA, not DNA. 
A.
B.
C.
D.
E.
58.  If the percentage of uracil in a double-stranded RNA molecule is 30%, the percentage of cytosine is?
A.
B.
C.
D.
E.
59.  Proto-oncogenes are found in normal, non-cancerous cells and are responsible for normal cell processes.
A.
B.
60.  Homologous genes found in different species that evolved from a common ancestor are called?
A.
B.
C.
D.
E.
61.  Which event is not normally associated with development of cancer?
A.
B.
C.
D.
E.
62.  Most genes in prokaryotes and eukaryotes are regulated primarily at which level of expression?
A.
B.
C.
D.
E.
63.  Chromatin contains
A.
B.
C.
D.
E.
64.  Which of the following groups of proteins is NOT commonly known to include oncogenes?
A.
B.
C.
D.
E.
65.  The correct order of activity in replication is
A.
B.
C.
D.
E.
66.                   contains an RNA molecule which is required for function.
A.
B.
C.
D.
E.
67.  The primary structure of a protein is determined by
A.
B.
C.
D.
E.
68.  Homologous genes in the same organism are called?
A.
B.
C.
D.
E.
69.  Proteins are composed of strings of nucleotides connected together by 5' - 3' phosphodiester bonds.
A.
B.
70.  Which of the following is most likely to cause a frameshift mutation?
A.
B.
C.
D.
E.
71.  The transfer of bacterial genes from one cell to another requires?
A.
B.
C.
D.
E.
72.  Given an inheritance pattern of incomplete dominance and 81 flowers are red (R1R1), 18 flowers are pink (R1R2), and 1 flower is white (R2R2), the frequency of the R1 allele is 0.9.
A.
B.
73.  For a species with a diploid number of 18 chromosomes, how many chromosomes will be present in the somatic nuclei of individuals that are tetraploid?
A.
B.
C.
D.
E.
74.  The phenomenon of crossovers in nearby regions is called
A.
B.
C.
D.
E.
75.  Which of the following statements is true:
A.
B.
C.
D.
E.
76.  ) If purple (P) is dominant to white (p) and axial (A) is dominant to terminal (a), and in a cross of white, axial to purple, axial the ratio of offspring is   6/16 white, axial;       2/16 white, terminal;       6/16 purple, axial;       2/16 purple, terminal,                                     What is the genotype of the parents?
A.
B.
C.
D.
E.
77.  The codon for methionine appears only at the beginning of the mRNA for a protein, not in the middle or in the end.
A.
B.
78.  Phosphorylation of pRB is carried out by?
A.
B.
C.
D.
E.
79.  The term used to describe genes that are evolutionarily related is?
A.
B.
C.
D.
E.
80.  The genetic material of eukaryotic cells is duplicated during which stage of cell cycle?
A.
B.
C.
D.
E.
81.  An organism's complete set of genes is called its 
A.
B.
C.
D.
E.
82.  Frameshift mutations generally have more drastic effects on the phenotype than do substitutions.
A.
B.
83.  The genetic code is said to be “degenerate” because 
A.
B.
C.
D.
84.  The ratio of (A+G) to (T+C) in a double-stranded DNA molecule is equal to 1
A.
B.
85.  Hershey and Chase differentiated between DNA and protein by:
A.
B.
C.
D.
E.
86.  A Barr body is an
A.
B.
C.
D.
87.  Which of the following is not different between eukaryotic and prokaryotic transcription?
A.
B.
C.
D.
E.
88.  Which of the following statements about an animal bearing a somatic mutation is true?
A.
B.
C.
D.
E.
89.  If the sequence of an RNA molecule is 5’-GGCAUCGACG-3’, what is the sequence of the template strand of DNA?
A.
B.
C.
D.
E.
90.  The basic structure of nucleotide includes the following components
A.
B.
C.
D.
E.
91.  Crossing over occurs most frequently during which stage of cell division? 
A.
B.
C.
D.
E.
92.  In catabolite repression of the lac operon, glucose affects most directly the
A.
B.
C.
D.
E.
93.  Regulation of the lac operon of E. coli by lactose is both negative and inducible
A.
B.
94.  In a double-stranded RNA molecule of 10,000 base pairs, the approximate number of complete turns is?
A.
B.
C.
D.
E.
95.  That some organisms contain much larger amounts of DNA than apparently "needed" and that some relatively closely related organisms may have vastly different amounts of DNA is more typical in
A.
B.
C.
D.
E.
96.  Chromosomal inversions result in duplications and deletions
A.
B.
97.  In lilies, white flowers (W) are dominant to purple flowers (w).  If two plants that are heterozygous for flower color are mated, the offspring might have which genotype? 
A.
B.
C.
D.
E.
98.  Bacterial Recombination requires?
A.
B.
C.
D.
E.
99.  Proto-oncogenes cause cancer.
A.
B.
100.  During replication, primase adds an RNA primer to DNA.
A.
B.
Back to top


to post comments.

Removing ad is a premium feature

Upgrade and get a lot more done!
Take Another Quiz