We have sent an email with your new password.

Close this window

Genetics Final Exam

100 Questions  I  By ProfGentle
Genetics Quizzes & Trivia
This is a Cumulative Exam focusing on Genetics

  
Changes are done, please start the quiz.


Question Excerpt

Removing question excerpt is a premium feature

Upgrade and get a lot more done!
1.  The mating system in E.coli is known as?
A.
B.
C.
D.
E.
2.  Enzyme involved in transcription of mRNA
A.
B.
C.
D.
3.  Nonsense mutations do not alter DNA sequence information.
A.
B.
4.  The transfer of bacterial genes from one cell to another requires?
A.
B.
C.
D.
E.
5.  An individual heterozygous for d e f was crossed to a homozygous recessive individual (d/d e/e f/f).  The following offspring were recovered. +  +  +             39 +  e  f               372 d  +  f               7 d  e  f               47 +  e  +              5 d  +  +              412  What is the correct order of these genes?
A.
B.
C.
6.  In an interacting gene pair, the gene whose expression is masked by another gene is the         gene.
A.
B.
C.
D.
E.
7.  DNA-dependent DNA polymerase
A.
B.
C.
D.
8.  Introns are removed from precursor mRNAs by spliceosomes
A.
B.
9.  ________ results when chromatids fail to separate and move to opposite poles during anaphase. 
A.
B.
C.
D.
E.
10.                  opens the double helix for replication machinery.
A.
B.
C.
D.
E.
11.  Proto-oncogenes are found in normal, non-cancerous cells and are responsible for normal cell processes.
A.
B.
12.  Hershey and Chase differentiated between DNA and protein by:
A.
B.
C.
D.
E.
13.  The basic structure of nucleotide includes the following components
A.
B.
C.
D.
E.
14.  The correct order of activity in replication is
A.
B.
C.
D.
E.
15.  The codon for methionine appears only at the beginning of the mRNA for a protein, not in the middle or in the end.
A.
B.
16.  Phosphorylation of pRB is carried out by?
A.
B.
C.
D.
E.
17.  In catabolite repression of the lac operon, glucose affects most directly the
A.
B.
C.
D.
E.
18.  The appearance of traits expressed by genes in association with environmental influence is referred to as the organism's 
A.
B.
C.
D.
E.
19.  A purine’s being replaced by a different purine is called a transition mutation.
A.
B.
20.  Which element of the lac operon can act in cis or trans?
A.
B.
C.
D.
E.
21.  Which of the following codon pairs specify amino acids
A.
B.
C.
D.
22.                  removes RNA primer.
A.
B.
C.
D.
E.
23.  Proto-oncogenes cause cancer.
A.
B.
24.  During replication, primase adds an RNA primer to DNA.
A.
B.
25.  Which of the following statements about an animal bearing a somatic mutation is true?
A.
B.
C.
D.
E.
26.  Which of the following groups of proteins is NOT commonly known to include oncogenes?
A.
B.
C.
D.
E.
27.  If the percentage of uracil in a double-stranded RNA molecule is 30%, the percentage of cytosine is?
A.
B.
C.
D.
E.
28.  If the sequence of a nontemplate strand of DNA is 5’-ACCGCATCCGAGTCAC-3’, what is the sequence of the primary product of transcription?
A.
B.
C.
D.
E.
29.  The phenomenon of crossovers in nearby regions is called
A.
B.
C.
D.
E.
30.     ??       speciation is initiated by a geographic barrier to gene flow
A.
B.
C.
D.
E.
31.  An organism's complete set of genes is called its 
A.
B.
C.
D.
E.
32.  Given the sequence 5’-AGTTACCTGA-3’ what would be the sequence of the complementary DNA strand?
A.
B.
C.
D.
E.
33.  Which of the following enzymes initiate chain synthesis on a template during replication? 
A.
B.
C.
D.
E.
34.  Which of the following is a nonhistone protein found in chromatin? 
A.
B.
C.
D.
35.  A(n)                  gene masks the expression of a different, nonallelic gene.
A.
B.
C.
D.
E.
36.  In the absence of allolactose, the lac operon is constitutively transcribed.
A.
B.
37.  Enzyme that charges tRNAs
A.
B.
C.
D.
38.  Which of the following statements is true:
A.
B.
C.
D.
E.
39.  When one speaks of a 5' cap, one is usually describing?
A.
B.
C.
D.
E.
40.  In a double-stranded RNA molecule of 10,000 base pairs, the approximate number of complete turns is?
A.
B.
C.
D.
E.
41.  What is the name for the statistical measure used to describe sample variability
A.
B.
C.
D.
E.
42.  Homologous genes in the same organism are called?
A.
B.
C.
D.
E.
43.  Mendel crossed purebred wrinkled, green-seeded plants with purebred round, yellow-seeded plants.  Round seeds are recessive to wrinkled, and yellow seeds are recessive to green. The F1 progeny were self-crossed.  Which of the following numbers are most likely to result from this cross.
A.
B.
C.
D.
E.
44.  Before a prokaryotic mRNA can be translated, it must be modified by the 
A.
B.
C.
D.
E.
45.  The chromosome theory of inheritance states that 
A.
B.
C.
D.
E.
46.  The term used to describe genes that are evolutionarily related is?
A.
B.
C.
D.
E.
47.  The presence of a single mutated gene is sufficient for retinoblastoma cancer to develop
A.
B.
48.  The genetic material of eukaryotic cells is duplicated during which stage of cell cycle?
A.
B.
C.
D.
E.
49.  Typically, a small subset of genes are expressed in each type of cell within an organism.
A.
B.
50.  The genetic code is said to be “degenerate” because 
A.
B.
C.
D.
51.  For any gene with multiple alleles, a diploid organism may have a maximum of ________ alleles for that locus.
A.
B.
C.
D.
E.
52.  Assume that a cross is made between tall and dwarf tobacco plants.  The F1 generation showed intermediate height, while the F2 generation showed a distribution of height ranging from tall to dwarf, like the original parents, and many heights between the extremes.  These data are consistent with the following mode of inheritance:
A.
B.
C.
D.
E.
53.  Which of the following must exist within a population before evolution can take place?
A.
B.
C.
D.
E.
54.  A wingless fruit fly is isolated from a population after exposure of the parental generation to EMS.  Eventually the mutation is shown to have occurred within the coding sequence of a gene that changes a 5’-GGC-3’ codon (encoding glycine) to a 5’-AGC-3’ codon (encoding serine).  Which term would not correctly describe this mutation?
A.
B.
C.
D.
E.
55.  Crossing over occurs most frequently during which stage of cell division? 
A.
B.
C.
D.
E.
56.  An allopolyploid consists of more than 2 haploid sets of chromosomes, originating from the same species.
A.
B.
57.  A man with blood type A and a woman with blood type B could never produce a child with blood type
A.
B.
C.
D.
E.
58.  The recombination frequency between three genes can be used to calculate
A.
B.
C.
D.
E.
59.  ) If purple (P) is dominant to white (p) and axial (A) is dominant to terminal (a), and in a cross of white, axial to purple, axial the ratio of offspring is   6/16 white, axial;       2/16 white, terminal;       6/16 purple, axial;       2/16 purple, terminal,                                     What is the genotype of the parents?
A.
B.
C.
D.
E.
60.  Chromatin contains
A.
B.
C.
D.
E.
61.  If the sequence of an RNA molecule is 5’-GGCAUCGACG-3’, what is the sequence of the template strand of DNA?
A.
B.
C.
D.
E.
62.                   contains an RNA molecule which is required for function.
A.
B.
C.
D.
E.
63.  Chromosomal inversions result in duplications and deletions
A.
B.
64.  All RNAs are translated.
A.
B.
65.  At the conclusion of meiosis, there are ________ cells
A.
B.
C.
D.
66.  Proteins are composed of strings of nucleotides connected together by 5' - 3' phosphodiester bonds.
A.
B.
67.  Enzyme involved in transcription of tRNA
A.
B.
C.
D.
68.  For a species with a diploid number of 18 chromosomes, how many chromosomes will be present in the somatic nuclei of individuals that are tetraploid?
A.
B.
C.
D.
E.
69.  The ratio of (A+G) to (T+C) in a double-stranded DNA molecule is equal to 1
A.
B.
70.  DNA synthesis in eukaryotes is?
A.
B.
C.
D.
E.
71.  In the absence of tryptophan, the genes of the trp operon are not expressed.
A.
B.
72.  Given the following sequence, how large (# amino acids) is the most likely eukaryotic polypeptide produced?                                       ACGAUGAGGAGGAUGGUCAAUGAUGCUGGCUGUUGAUAUUAACAU
A.
B.
C.
D.
E.
73.  The primary structure of a protein is determined by
A.
B.
C.
D.
E.
74.  A person who is known to have a particular genotype does not show the phenotype specified by the gene. This is an example of 
A.
B.
C.
D.
E.
75.                 actually synthesizes RNA, not DNA. 
A.
B.
C.
D.
E.
76.      ??      speciation arises in the absence of any geographic barrier to gene flow:
A.
B.
C.
D.
E.
77.  A eukaryotic promoter contains a Pribnow box
A.
B.
78.  Homologous genes found in different species that evolved from a common ancestor are called?
A.
B.
C.
D.
E.
79.  Regulation of the lac operon of E. coli by lactose is both negative and inducible
A.
B.
80.  Which of the following is not different between eukaryotic and prokaryotic transcription?
A.
B.
C.
D.
E.
81.  The two major components of Tobacco Mosaic Virus are?
A.
B.
C.
D.
E.
82.                  relieves torsional stress.
A.
B.
C.
D.
E.
83.  Plasmids that can confer the ability to conjugate are known as?
A.
B.
C.
D.
E.
84.  Which of the following is most likely to cause a frameshift mutation?
A.
B.
C.
D.
E.
85.  In a pea plant that is heterozygous for seed color, what proportion of gametes will carry the recessive allele?
A.
B.
C.
D.
E.
86.  For most protein-encoding genes, the synonymous rate of change is:
A.
B.
C.
D.
E.
87.  In the absence of glucose, the CAP protein binds to a DNA sequence adjacent to the promoter of the lac operon.  Binding of CAP helps RNA polymerase to bind to the promoter and allows for a high level of transcription of the lac operon.  Regulation of the lac operon by the CAP protein is an example of
A.
B.
C.
D.
E.
88.  The ratio of (A+T) to (G+C) in a double-stranded DNA molecule is equal to 1
A.
B.
89.  Bacterial Recombination requires?
A.
B.
C.
D.
E.
90.  In human males, genes on the X chromosome are
A.
B.
C.
D.
E.
91.  Which event is not normally associated with development of cancer?
A.
B.
C.
D.
E.
92.  G and U are present in both DNA and RNA
A.
B.
93.  Given an inheritance pattern of incomplete dominance and 81 flowers are red (R1R1), 18 flowers are pink (R1R2), and 1 flower is white (R2R2), the frequency of the R1 allele is 0.9.
A.
B.
94.  Messenger RNA is usually polycistronic in eukaryotes
A.
B.
95.  The sugar ribose differs from deoxyribose by an OH group at the 5' C position 
A.
B.
96.  Frameshift mutations generally have more drastic effects on the phenotype than do substitutions.
A.
B.
97.  A Barr body is an
A.
B.
C.
D.
98.  Most genes in prokaryotes and eukaryotes are regulated primarily at which level of expression?
A.
B.
C.
D.
E.
99.  In lilies, white flowers (W) are dominant to purple flowers (w).  If two plants that are heterozygous for flower color are mated, the offspring might have which genotype? 
A.
B.
C.
D.
E.
100.  That some organisms contain much larger amounts of DNA than apparently "needed" and that some relatively closely related organisms may have vastly different amounts of DNA is more typical in
A.
B.
C.
D.
E.
Back to top

Removing ad is a premium feature

Upgrade and get a lot more done!
Take Another Quiz