Genetics Final Exam

100 Questions  I  By ProfGentle
Please take the quiz to rate it.

Genetics Quizzes & Trivia
This is a Cumulative Exam focusing on Genetics

  
Changes are done, please start the quiz.


Questions and Answers Excerpt

Removing question excerpt is a premium feature

Upgrade and get a lot more done!
1.  Messenger RNA is usually polycistronic in eukaryotes
A.
B.
2.  Enzyme that charges tRNAs
A.
B.
C.
D.
3.  The phenomenon of crossovers in nearby regions is called
A.
B.
C.
D.
E.
4.  For a species with a diploid number of 18 chromosomes, how many chromosomes will be present in the somatic nuclei of individuals that are tetraploid?
A.
B.
C.
D.
E.
5.  The genetic material of eukaryotic cells is duplicated during which stage of cell cycle?
A.
B.
C.
D.
E.
6.  The correct order of activity in replication is
A.
B.
C.
D.
E.
7.  Homologous genes in the same organism are called?
A.
B.
C.
D.
E.
8.  Homologous genes found in different species that evolved from a common ancestor are called?
A.
B.
C.
D.
E.
9.  Introns are removed from precursor mRNAs by spliceosomes
A.
B.
10.  For most protein-encoding genes, the synonymous rate of change is:
A.
B.
C.
D.
E.
11.  Proto-oncogenes cause cancer.
A.
B.
12.  Given an inheritance pattern of incomplete dominance and 81 flowers are red (R1R1), 18 flowers are pink (R1R2), and 1 flower is white (R2R2), the frequency of the R1 allele is 0.9.
A.
B.
13.  In the absence of glucose, the CAP protein binds to a DNA sequence adjacent to the promoter of the lac operon.  Binding of CAP helps RNA polymerase to bind to the promoter and allows for a high level of transcription of the lac operon.  Regulation of the lac operon by the CAP protein is an example of
A.
B.
C.
D.
E.
14.  In lilies, white flowers (W) are dominant to purple flowers (w).  If two plants that are heterozygous for flower color are mated, the offspring might have which genotype? 
A.
B.
C.
D.
E.
15.  G and U are present in both DNA and RNA
A.
B.
16.  The basic structure of nucleotide includes the following components
A.
B.
C.
D.
E.
17.  An individual heterozygous for d e f was crossed to a homozygous recessive individual (d/d e/e f/f).  The following offspring were recovered. +  +  +             39 +  e  f               372 d  +  f               7 d  e  f               47 +  e  +              5 d  +  +              412  What is the correct order of these genes?
A.
B.
C.
18.  Given the following sequence, how large (# amino acids) is the most likely eukaryotic polypeptide produced?                                       ACGAUGAGGAGGAUGGUCAAUGAUGCUGGCUGUUGAUAUUAACAU
A.
B.
C.
D.
E.
19.  Which of the following is a nonhistone protein found in chromatin? 
A.
B.
C.
D.
20.  Which element of the lac operon can act in cis or trans?
A.
B.
C.
D.
E.
21.  Typically, a small subset of genes are expressed in each type of cell within an organism.
A.
B.
22.  If the percentage of uracil in a double-stranded RNA molecule is 30%, the percentage of cytosine is?
A.
B.
C.
D.
E.
23.  Which of the following groups of proteins is NOT commonly known to include oncogenes?
A.
B.
C.
D.
E.
24.  Nonsense mutations do not alter DNA sequence information.
A.
B.
25.  Which of the following is not different between eukaryotic and prokaryotic transcription?
A.
B.
C.
D.
E.
26.  The presence of a single mutated gene is sufficient for retinoblastoma cancer to develop
A.
B.
27.  A(n)                  gene masks the expression of a different, nonallelic gene.
A.
B.
C.
D.
E.
28.  The chromosome theory of inheritance states that 
A.
B.
C.
D.
E.
29.  If the sequence of an RNA molecule is 5’-GGCAUCGACG-3’, what is the sequence of the template strand of DNA?
A.
B.
C.
D.
E.
30.  Assume that a cross is made between tall and dwarf tobacco plants.  The F1 generation showed intermediate height, while the F2 generation showed a distribution of height ranging from tall to dwarf, like the original parents, and many heights between the extremes.  These data are consistent with the following mode of inheritance:
A.
B.
C.
D.
E.
31.     ??       speciation is initiated by a geographic barrier to gene flow
A.
B.
C.
D.
E.
32.  In an interacting gene pair, the gene whose expression is masked by another gene is the         gene.
A.
B.
C.
D.
E.
33.  Enzyme involved in transcription of mRNA
A.
B.
C.
D.
34.  The mating system in E.coli is known as?
A.
B.
C.
D.
E.
35.  Frameshift mutations generally have more drastic effects on the phenotype than do substitutions.
A.
B.
36.                   contains an RNA molecule which is required for function.
A.
B.
C.
D.
E.
37.  The sugar ribose differs from deoxyribose by an OH group at the 5' C position 
A.
B.
38.  Most genes in prokaryotes and eukaryotes are regulated primarily at which level of expression?
A.
B.
C.
D.
E.
39.  For any gene with multiple alleles, a diploid organism may have a maximum of ________ alleles for that locus.
A.
B.
C.
D.
E.
40.      ??      speciation arises in the absence of any geographic barrier to gene flow:
A.
B.
C.
D.
E.
41.  ________ results when chromatids fail to separate and move to opposite poles during anaphase. 
A.
B.
C.
D.
E.
42.  Which of the following statements is true:
A.
B.
C.
D.
E.
43.  That some organisms contain much larger amounts of DNA than apparently "needed" and that some relatively closely related organisms may have vastly different amounts of DNA is more typical in
A.
B.
C.
D.
E.
44.  Which of the following statements about an animal bearing a somatic mutation is true?
A.
B.
C.
D.
E.
45.  All RNAs are translated.
A.
B.
46.  The transfer of bacterial genes from one cell to another requires?
A.
B.
C.
D.
E.
47.  A Barr body is an
A.
B.
C.
D.
48.  Crossing over occurs most frequently during which stage of cell division? 
A.
B.
C.
D.
E.
49.  Which of the following must exist within a population before evolution can take place?
A.
B.
C.
D.
E.
50.  Phosphorylation of pRB is carried out by?
A.
B.
C.
D.
E.
51.  The codon for methionine appears only at the beginning of the mRNA for a protein, not in the middle or in the end.
A.
B.
52.  A wingless fruit fly is isolated from a population after exposure of the parental generation to EMS.  Eventually the mutation is shown to have occurred within the coding sequence of a gene that changes a 5’-GGC-3’ codon (encoding glycine) to a 5’-AGC-3’ codon (encoding serine).  Which term would not correctly describe this mutation?
A.
B.
C.
D.
E.
53.  The two major components of Tobacco Mosaic Virus are?
A.
B.
C.
D.
E.
54.                  opens the double helix for replication machinery.
A.
B.
C.
D.
E.
55.  Proteins are composed of strings of nucleotides connected together by 5' - 3' phosphodiester bonds.
A.
B.
56.  The term used to describe genes that are evolutionarily related is?
A.
B.
C.
D.
E.
57.  Mendel crossed purebred wrinkled, green-seeded plants with purebred round, yellow-seeded plants.  Round seeds are recessive to wrinkled, and yellow seeds are recessive to green. The F1 progeny were self-crossed.  Which of the following numbers are most likely to result from this cross.
A.
B.
C.
D.
E.
58.  ) If purple (P) is dominant to white (p) and axial (A) is dominant to terminal (a), and in a cross of white, axial to purple, axial the ratio of offspring is   6/16 white, axial;       2/16 white, terminal;       6/16 purple, axial;       2/16 purple, terminal,                                     What is the genotype of the parents?
A.
B.
C.
D.
E.
59.  In the absence of tryptophan, the genes of the trp operon are not expressed.
A.
B.
60.  Which of the following codon pairs specify amino acids
A.
B.
C.
D.
61.  Which of the following enzymes initiate chain synthesis on a template during replication? 
A.
B.
C.
D.
E.
62.                 actually synthesizes RNA, not DNA. 
A.
B.
C.
D.
E.
63.  The appearance of traits expressed by genes in association with environmental influence is referred to as the organism's 
A.
B.
C.
D.
E.
64.  Hershey and Chase differentiated between DNA and protein by:
A.
B.
C.
D.
E.
65.  Proto-oncogenes are found in normal, non-cancerous cells and are responsible for normal cell processes.
A.
B.
66.  A man with blood type A and a woman with blood type B could never produce a child with blood type
A.
B.
C.
D.
E.
67.  Bacterial Recombination requires?
A.
B.
C.
D.
E.
68.  Before a prokaryotic mRNA can be translated, it must be modified by the 
A.
B.
C.
D.
E.
69.  The recombination frequency between three genes can be used to calculate
A.
B.
C.
D.
E.
70.  In a double-stranded RNA molecule of 10,000 base pairs, the approximate number of complete turns is?
A.
B.
C.
D.
E.
71.  In human males, genes on the X chromosome are
A.
B.
C.
D.
E.
72.  The genetic code is said to be “degenerate” because 
A.
B.
C.
D.
73.  The ratio of (A+G) to (T+C) in a double-stranded DNA molecule is equal to 1
A.
B.
74.  Chromatin contains
A.
B.
C.
D.
E.
75.  Regulation of the lac operon of E. coli by lactose is both negative and inducible
A.
B.
76.                  removes RNA primer.
A.
B.
C.
D.
E.
77.  In a pea plant that is heterozygous for seed color, what proportion of gametes will carry the recessive allele?
A.
B.
C.
D.
E.
78.  A purine’s being replaced by a different purine is called a transition mutation.
A.
B.
79.  Which event is not normally associated with development of cancer?
A.
B.
C.
D.
E.
80.  The primary structure of a protein is determined by
A.
B.
C.
D.
E.
81.  A person who is known to have a particular genotype does not show the phenotype specified by the gene. This is an example of 
A.
B.
C.
D.
E.
82.  Given the sequence 5’-AGTTACCTGA-3’ what would be the sequence of the complementary DNA strand?
A.
B.
C.
D.
E.
83.  DNA synthesis in eukaryotes is?
A.
B.
C.
D.
E.
84.  Enzyme involved in transcription of tRNA
A.
B.
C.
D.
85.  If the sequence of a nontemplate strand of DNA is 5’-ACCGCATCCGAGTCAC-3’, what is the sequence of the primary product of transcription?
A.
B.
C.
D.
E.
86.  The ratio of (A+T) to (G+C) in a double-stranded DNA molecule is equal to 1
A.
B.
87.  An allopolyploid consists of more than 2 haploid sets of chromosomes, originating from the same species.
A.
B.
88.  When one speaks of a 5' cap, one is usually describing?
A.
B.
C.
D.
E.
89.  Chromosomal inversions result in duplications and deletions
A.
B.
90.  During replication, primase adds an RNA primer to DNA.
A.
B.
91.                  relieves torsional stress.
A.
B.
C.
D.
E.
92.  A eukaryotic promoter contains a Pribnow box
A.
B.
93.  Which of the following is most likely to cause a frameshift mutation?
A.
B.
C.
D.
E.
94.  Plasmids that can confer the ability to conjugate are known as?
A.
B.
C.
D.
E.
95.  In the absence of allolactose, the lac operon is constitutively transcribed.
A.
B.
96.  What is the name for the statistical measure used to describe sample variability
A.
B.
C.
D.
E.
97.  DNA-dependent DNA polymerase
A.
B.
C.
D.
98.  An organism's complete set of genes is called its 
A.
B.
C.
D.
E.
99.  At the conclusion of meiosis, there are ________ cells
A.
B.
C.
D.
100.  In catabolite repression of the lac operon, glucose affects most directly the
A.
B.
C.
D.
E.
Back to top

Removing ad is a premium feature

Upgrade and get a lot more done!
Take Another Quiz
We have sent an email with your new password.