Genetics Final Exam

100 Questions  I  By ProfGentle on December 6, 2010
This is a Cumulative Exam focusing on Genetics

  
Changes are done, please start the quiz.


Question Excerpt

Removing question excerpt is a premium feature

Upgrade and get a lot more done!
1.  Mendel crossed purebred wrinkled, green-seeded plants with purebred round, yellow-seeded plants.  Round seeds are recessive to wrinkled, and yellow seeds are recessive to green. The F1 progeny were self-crossed.  Which of the following numbers are most likely to result from this cross.
A.
B.
C.
D.
E.
2.  An organism's complete set of genes is called its 
A.
B.
C.
D.
E.
3.  Enzyme involved in transcription of tRNA
A.
B.
C.
D.
4.  An individual heterozygous for d e f was crossed to a homozygous recessive individual (d/d e/e f/f).  The following offspring were recovered. +  +  +             39 +  e  f               372 d  +  f               7 d  e  f               47 +  e  +              5 d  +  +              412  What is the correct order of these genes?
A.
B.
C.
5.  A(n)                  gene masks the expression of a different, nonallelic gene.
A.
B.
C.
D.
E.
6.  The primary structure of a protein is determined by
A.
B.
C.
D.
E.
7.  Which of the following is most likely to cause a frameshift mutation?
A.
B.
C.
D.
E.
8.  Which of the following groups of proteins is NOT commonly known to include oncogenes?
A.
B.
C.
D.
E.
9.  The two major components of Tobacco Mosaic Virus are?
A.
B.
C.
D.
E.
10.  Frameshift mutations generally have more drastic effects on the phenotype than do substitutions.
A.
B.
11.  The ratio of (A+G) to (T+C) in a double-stranded DNA molecule is equal to 1
A.
B.
12.  In the absence of glucose, the CAP protein binds to a DNA sequence adjacent to the promoter of the lac operon.  Binding of CAP helps RNA polymerase to bind to the promoter and allows for a high level of transcription of the lac operon.  Regulation of the lac operon by the CAP protein is an example of
A.
B.
C.
D.
E.
13.  The correct order of activity in replication is
A.
B.
C.
D.
E.
14.  Crossing over occurs most frequently during which stage of cell division? 
A.
B.
C.
D.
E.
15.  What is the name for the statistical measure used to describe sample variability
A.
B.
C.
D.
E.
16.  Proteins are composed of strings of nucleotides connected together by 5' - 3' phosphodiester bonds.
A.
B.
17.  Which of the following codon pairs specify amino acids
A.
B.
C.
D.
18.  For a species with a diploid number of 18 chromosomes, how many chromosomes will be present in the somatic nuclei of individuals that are tetraploid?
A.
B.
C.
D.
E.
19.  G and U are present in both DNA and RNA
A.
B.
20.  A person who is known to have a particular genotype does not show the phenotype specified by the gene. This is an example of 
A.
B.
C.
D.
E.
21.  Given the sequence 5’-AGTTACCTGA-3’ what would be the sequence of the complementary DNA strand?
A.
B.
C.
D.
E.
22.  Assume that a cross is made between tall and dwarf tobacco plants.  The F1 generation showed intermediate height, while the F2 generation showed a distribution of height ranging from tall to dwarf, like the original parents, and many heights between the extremes.  These data are consistent with the following mode of inheritance:
A.
B.
C.
D.
E.
23.  Chromosomal inversions result in duplications and deletions
A.
B.
24.  In a double-stranded RNA molecule of 10,000 base pairs, the approximate number of complete turns is?
A.
B.
C.
D.
E.
25.  In a pea plant that is heterozygous for seed color, what proportion of gametes will carry the recessive allele?
A.
B.
C.
D.
E.
26.  All RNAs are translated.
A.
B.
27.  In lilies, white flowers (W) are dominant to purple flowers (w).  If two plants that are heterozygous for flower color are mated, the offspring might have which genotype? 
A.
B.
C.
D.
E.
28.  The sugar ribose differs from deoxyribose by an OH group at the 5' C position 
A.
B.
29.  Enzyme that charges tRNAs
A.
B.
C.
D.
30.  For most protein-encoding genes, the synonymous rate of change is:
A.
B.
C.
D.
E.
31.  Which of the following statements about an animal bearing a somatic mutation is true?
A.
B.
C.
D.
E.
32.  Which of the following enzymes initiate chain synthesis on a template during replication? 
A.
B.
C.
D.
E.
33.  Phosphorylation of pRB is carried out by?
A.
B.
C.
D.
E.
34.                  removes RNA primer.
A.
B.
C.
D.
E.
35.  The appearance of traits expressed by genes in association with environmental influence is referred to as the organism's 
A.
B.
C.
D.
E.
36.  Proto-oncogenes are found in normal, non-cancerous cells and are responsible for normal cell processes.
A.
B.
37.  The genetic code is said to be “degenerate” because 
A.
B.
C.
D.
38.  A purine’s being replaced by a different purine is called a transition mutation.
A.
B.
39.     ??       speciation is initiated by a geographic barrier to gene flow
A.
B.
C.
D.
E.
40.  Which event is not normally associated with development of cancer?
A.
B.
C.
D.
E.
41.  If the percentage of uracil in a double-stranded RNA molecule is 30%, the percentage of cytosine is?
A.
B.
C.
D.
E.
42.  Homologous genes found in different species that evolved from a common ancestor are called?
A.
B.
C.
D.
E.
43.                  opens the double helix for replication machinery.
A.
B.
C.
D.
E.
44.  Bacterial Recombination requires?
A.
B.
C.
D.
E.
45.  ________ results when chromatids fail to separate and move to opposite poles during anaphase. 
A.
B.
C.
D.
E.
46.  Before a prokaryotic mRNA can be translated, it must be modified by the 
A.
B.
C.
D.
E.
47.                 actually synthesizes RNA, not DNA. 
A.
B.
C.
D.
E.
48.      ??      speciation arises in the absence of any geographic barrier to gene flow:
A.
B.
C.
D.
E.
49.  Chromatin contains
A.
B.
C.
D.
E.
50.  Nonsense mutations do not alter DNA sequence information.
A.
B.
51.  Most genes in prokaryotes and eukaryotes are regulated primarily at which level of expression?
A.
B.
C.
D.
E.
52.  In catabolite repression of the lac operon, glucose affects most directly the
A.
B.
C.
D.
E.
53.  In the absence of allolactose, the lac operon is constitutively transcribed.
A.
B.
54.  The genetic material of eukaryotic cells is duplicated during which stage of cell cycle?
A.
B.
C.
D.
E.
55.  Which of the following statements is true:
A.
B.
C.
D.
E.
56.  Which of the following is not different between eukaryotic and prokaryotic transcription?
A.
B.
C.
D.
E.
57.  Which of the following must exist within a population before evolution can take place?
A.
B.
C.
D.
E.
58.  A eukaryotic promoter contains a Pribnow box
A.
B.
59.                  relieves torsional stress.
A.
B.
C.
D.
E.
60.  Hershey and Chase differentiated between DNA and protein by:
A.
B.
C.
D.
E.
61.  The recombination frequency between three genes can be used to calculate
A.
B.
C.
D.
E.
62.  Typically, a small subset of genes are expressed in each type of cell within an organism.
A.
B.
63.  ) If purple (P) is dominant to white (p) and axial (A) is dominant to terminal (a), and in a cross of white, axial to purple, axial the ratio of offspring is   6/16 white, axial;       2/16 white, terminal;       6/16 purple, axial;       2/16 purple, terminal,                                     What is the genotype of the parents?
A.
B.
C.
D.
E.
64.  An allopolyploid consists of more than 2 haploid sets of chromosomes, originating from the same species.
A.
B.
65.  In the absence of tryptophan, the genes of the trp operon are not expressed.
A.
B.
66.  The transfer of bacterial genes from one cell to another requires?
A.
B.
C.
D.
E.
67.  The phenomenon of crossovers in nearby regions is called
A.
B.
C.
D.
E.
68.  A Barr body is an
A.
B.
C.
D.
69.  Which element of the lac operon can act in cis or trans?
A.
B.
C.
D.
E.
70.  Regulation of the lac operon of E. coli by lactose is both negative and inducible
A.
B.
71.  Messenger RNA is usually polycistronic in eukaryotes
A.
B.
72.  The basic structure of nucleotide includes the following components
A.
B.
C.
D.
E.
73.  If the sequence of a nontemplate strand of DNA is 5’-ACCGCATCCGAGTCAC-3’, what is the sequence of the primary product of transcription?
A.
B.
C.
D.
E.
74.  That some organisms contain much larger amounts of DNA than apparently "needed" and that some relatively closely related organisms may have vastly different amounts of DNA is more typical in
A.
B.
C.
D.
E.
75.  The mating system in E.coli is known as?
A.
B.
C.
D.
E.
76.  For any gene with multiple alleles, a diploid organism may have a maximum of ________ alleles for that locus.
A.
B.
C.
D.
E.
77.  The term used to describe genes that are evolutionarily related is?
A.
B.
C.
D.
E.
78.  If the sequence of an RNA molecule is 5’-GGCAUCGACG-3’, what is the sequence of the template strand of DNA?
A.
B.
C.
D.
E.
79.  A man with blood type A and a woman with blood type B could never produce a child with blood type
A.
B.
C.
D.
E.
80.  Given the following sequence, how large (# amino acids) is the most likely eukaryotic polypeptide produced?                                       ACGAUGAGGAGGAUGGUCAAUGAUGCUGGCUGUUGAUAUUAACAU
A.
B.
C.
D.
E.
81.  Plasmids that can confer the ability to conjugate are known as?
A.
B.
C.
D.
E.
82.  DNA-dependent DNA polymerase
A.
B.
C.
D.
83.  The chromosome theory of inheritance states that 
A.
B.
C.
D.
E.
84.  The codon for methionine appears only at the beginning of the mRNA for a protein, not in the middle or in the end.
A.
B.
85.                   contains an RNA molecule which is required for function.
A.
B.
C.
D.
E.
86.  In an interacting gene pair, the gene whose expression is masked by another gene is the         gene.
A.
B.
C.
D.
E.
87.  In human males, genes on the X chromosome are
A.
B.
C.
D.
E.
88.  DNA synthesis in eukaryotes is?
A.
B.
C.
D.
E.
89.  Which of the following is a nonhistone protein found in chromatin? 
A.
B.
C.
D.
90.  Enzyme involved in transcription of mRNA
A.
B.
C.
D.
91.  Given an inheritance pattern of incomplete dominance and 81 flowers are red (R1R1), 18 flowers are pink (R1R2), and 1 flower is white (R2R2), the frequency of the R1 allele is 0.9.
A.
B.
92.  When one speaks of a 5' cap, one is usually describing?
A.
B.
C.
D.
E.
93.  The ratio of (A+T) to (G+C) in a double-stranded DNA molecule is equal to 1
A.
B.
94.  Introns are removed from precursor mRNAs by spliceosomes
A.
B.
95.  Proto-oncogenes cause cancer.
A.
B.
96.  The presence of a single mutated gene is sufficient for retinoblastoma cancer to develop
A.
B.
97.  During replication, primase adds an RNA primer to DNA.
A.
B.
98.  Homologous genes in the same organism are called?