Genetics Final Exam

100 Questions  I  By ProfGentle
Please take the quiz to rate it.

Genetics Quizzes & Trivia
This is a Cumulative Exam focusing on Genetics

  
Changes are done, please start the quiz.


Questions and Answers

Removing question excerpt is a premium feature

Upgrade and get a lot more done!
  • 1. 
    In a pea plant that is heterozygous for seed color, what proportion of gametes will carry the recessive allele?
    • A. 

      1/4

    • B. 

      1/2

    • C. 

      1/3

    • D. 

      All of the gametes

    • E. 

      None of the gametes


  • 2. 
    A(n)                  gene masks the expression of a different, nonallelic gene.
    • A. 

      Imcompletely dominant

    • B. 

      Epistatic

    • C. 

      Recessive

    • D. 

      Codominant

    • E. 

      Hemizygous


  • 3. 
    The genetic material of eukaryotic cells is duplicated during which stage of cell cycle?
    • A. 

      M

    • B. 

      S

    • C. 

      G1

    • D. 

      G2

    • E. 

      None of the above


  • 4. 
    The appearance of traits expressed by genes in association with environmental influence is referred to as the organism's 
    • A. 

      Genome

    • B. 

      Karyotype

    • C. 

      Phenotype

    • D. 

      Genotype

    • E. 

      Prototype


  • 5. 
    A man with blood type A and a woman with blood type B could never produce a child with blood type
    • A. 

      A

    • B. 

      B

    • C. 

      AB

    • D. 

      O

    • E. 

      None of the above


  • 6. 
    In an interacting gene pair, the gene whose expression is masked by another gene is the         gene.
    • A. 

      Epistatic

    • B. 

      Homostatic

    • C. 

      Hypostatic

    • D. 

      Hyperstatic

    • E. 

      Limnostatic


  • 7. 
    In human males, genes on the X chromosome are
    • A. 

      Homozygous

    • B. 

      Heterozygous

    • C. 

      Homogametic

    • D. 

      Heterogametic

    • E. 

      Hemizygous


  • 8. 
    A Barr body is an
    • A. 

      Active X chromosome

    • B. 

      Inactive Y chromosome

    • C. 

      Inactive X chromosome

    • D. 

      Active Y chromosome


  • 9. 
    The basic structure of nucleotide includes the following components
    • A. 

      Amino acids

    • B. 

      Base, sugar, phosphate

    • C. 

      Tryptophan and leucine

    • D. 

      MRNA, rRNA, tRNA

    • E. 

      Phosphorus and sulfur


  • 10. 
    Bacterial Recombination requires?
    • A. 

      F pilus

    • B. 

      Plasmid

    • C. 

      Physical contact

    • D. 

      All of the above

    • E. 

      None of the above


  • 11. 
    The two major components of Tobacco Mosaic Virus are?
    • A. 

      DNA and RNA

    • B. 

      RNA and Protein

    • C. 

      DNA and Protein

    • D. 

      Lipids and nucleic acids

    • E. 

      Carbohydrates and nucleic acids


  • 12. 
    Which of the following enzymes initiate chain synthesis on a template during replication? 
    • A. 

      DNA pol I

    • B. 

      DNA pol II

    • C. 

      DNA pol III

    • D. 

      RNA pol II

    • E. 

      Primase


  • 13. 
    Assume that a cross is made between tall and dwarf tobacco plants.  The F1 generation showed intermediate height, while the F2 generation showed a distribution of height ranging from tall to dwarf, like the original parents, and many heights between the extremes.  These data are consistent with the following mode of inheritance:
    • A. 

      Multiple-factor inheritance

    • B. 

      Alternation of generations

    • C. 

      Codominance

    • D. 

      Incomplete dominance

    • E. 

      Hemizygosity


  • 14. 
    Given the sequence 5’-AGTTACCTGA-3’ what would be the sequence of the complementary DNA strand?
    • A. 

      5’-TCAATGGACT-3’

    • B. 

      3’-AGTTACCTGA-5’

    • C. 

      5’-AGTTACCTGA-3’

    • D. 

      3’-TCAGGTAACT-5’

    • E. 

      5’-TCAGGTAACT-3’


  • 15. 
    If the percentage of uracil in a double-stranded RNA molecule is 30%, the percentage of cytosine is?
    • A. 

      20%

    • B. 

      10%

    • C. 

      30%

    • D. 

      60%

    • E. 

      40%


  • 16. 
    In a double-stranded RNA molecule of 10,000 base pairs, the approximate number of complete turns is?
    • A. 

      3000

    • B. 

      15,000

    • C. 

      1000

    • D. 

      300

    • E. 

      30


  • 17. 
    Hershey and Chase differentiated between DNA and protein by:
    • A. 

      Labeling the DNA with 14Carbon, proteins with 3Hydrogen

    • B. 

      Labeling the DNA with 35Sulfur, proteins with 32Phosphorous

    • C. 

      Labeling the DNA with cesium, proteins with chloride

    • D. 

      Labeling the DNA with 32Phosphorous, proteins with 35Sulfur

    • E. 

      All of the above


  • 18. 
    What is the name for the statistical measure used to describe sample variability
    • A. 

      Mean

    • B. 

      Standard Error

    • C. 

      Variance

    • D. 

      Median

    • E. 

      Covariance


  • 19. 
    For a species with a diploid number of 18 chromosomes, how many chromosomes will be present in the somatic nuclei of individuals that are tetraploid?
    • A. 

      9

    • B. 

      27

    • C. 

      36

    • D. 

      18

    • E. 

      72


  • 20. 
    ________ results when chromatids fail to separate and move to opposite poles during anaphase. 
    • A. 

      Nondisjunction

    • B. 

      Transposition

    • C. 

      Translocation

    • D. 

      Duplication

    • E. 

      Segregation


  • 21. 
    The recombination frequency between three genes can be used to calculate
    • A. 

      Actual distance between genes

    • B. 

      Gene order

    • C. 

      Number of tetrads

    • D. 

      All of the above

    • E. 

      None of the above


  • 22. 
    The phenomenon of crossovers in nearby regions is called
    • A. 

      Chiasma

    • B. 

      Negative Interference

    • C. 

      Reciprocal genetic exchange

    • D. 

      Positive Interference

    • E. 

      Mitotic recombination


  • 23. 
    The mating system in E.coli is known as?
    • A. 

      Lysogeny

    • B. 

      Lysis

    • C. 

      Conjugation

    • D. 

      Integration

    • E. 

      Transduction


  • 24. 
    The transfer of bacterial genes from one cell to another requires?
    • A. 

      F factor

    • B. 

      F plasmids

    • C. 

      F + cell

    • D. 

      All of the above

    • E. 

      None of the above


  • 25. 
    Which of the following is a nonhistone protein found in chromatin? 
    • A. 

      H1

    • B. 

      HMG

    • C. 

      H2A

    • D. 

      H3


  • 26. 
    Chromatin contains
    • A. 

      A) DNA.

    • B. 

      B) RNA.

    • C. 

      C) protein.

    • D. 

      D) both A and C

    • E. 

      E) all of the above


  • 27. 
    Plasmids that can confer the ability to conjugate are known as?
    • A. 

      F plasmids

    • B. 

      Colicin plasmids

    • C. 

      Bacteriophage

    • D. 

      E. coli

    • E. 

      R plasmids


  • 28. 
    Which of the following codon pairs specify amino acids
    • A. 

      AUG and GUG

    • B. 

      UGA and AUG

    • C. 

      AUG and UAA

    • D. 

      UAA and UGA


  • 29. 
    DNA synthesis in eukaryotes is?
    • A. 

      Semi-conservative

    • B. 

      Proceeds in a 3’ to 5’ direction

    • C. 

      Involves a single protein

    • D. 

      All of the above

    • E. 

      None of the above


  • 30. 
                   actually synthesizes RNA, not DNA. 
    • A. 

      DNA Pol I

    • B. 

      Telomerase

    • C. 

      Helicase

    • D. 

      Primase

    • E. 

      Gyrase


  • 31. 
                     contains an RNA molecule which is required for function.
    • A. 

      DNA Pol I

    • B. 

      Telomerase

    • C. 

      Helicase

    • D. 

      Primase

    • E. 

      Gyrase


  • 32. 
                    relieves torsional stress.
    • A. 

      DNA Pol I

    • B. 

      Telomerase

    • C. 

      Helicase

    • D. 

      Primase

    • E. 

      Gyrase


  • 33. 
                    opens the double helix for replication machinery.
    • A. 

      DNA Pol I

    • B. 

      Telomerase

    • C. 

      Helicase

    • D. 

      Primase

    • E. 

      Gyrase


  • 34. 
                    removes RNA primer.
    • A. 

      DNA Pol I

    • B. 

      Telomerase

    • C. 

      Helicase

    • D. 

      Primase

    • E. 

      Gyrase


  • 35. 
    Which of the following is not different between eukaryotic and prokaryotic transcription?
    • A. 

      Splicing

    • B. 

      5' capping

    • C. 

      Poly-adenylation

    • D. 

      Termination

    • E. 

      All are different


  • 36. 
    The correct order of activity in replication is
    • A. 

      Helicase, SSB, Pol III, primase, Pol I, ligase

    • B. 

      Primase, helicase, SSB, Pol III, Pol I, ligase

    • C. 

      SSB, helicase, primase, Pol III, Pol I, ligase

    • D. 

      Helicase, SSB, primase, Pol I, Pol III, ligase

    • E. 

      Helicase, SSB, primase, Pol III, Pol I, ligase


  • 37. 
    Before a prokaryotic mRNA can be translated, it must be modified by the 
    • A. 

      Addition of a 5' cap.

    • B. 

      Addition of a polyA tail

    • C. 

      Removal of introns

    • D. 

      All of the above

    • E. 

      None of the above


  • 38. 
    Enzyme involved in transcription of tRNA
    • A. 

      DNA Polymerase I

    • B. 

      RNA Polymerase II

    • C. 

      Aminoacyl transferase

    • D. 

      RNA Polymerase III


  • 39. 
    Enzyme involved in transcription of mRNA
    • A. 

      DNA Polymerase I

    • B. 

      RNA Polymerase II

    • C. 

      Aminoacyl transferase

    • D. 

      RNA Polymerase III


  • 40. 
    DNA-dependent DNA polymerase
    • A. 

      DNA Polymerase I

    • B. 

      RNA Polymerase II

    • C. 

      Aminoacyl transferase

    • D. 

      RNA Polymerase III


  • 41. 
    Enzyme that charges tRNAs
    • A. 

      DNA Polymerase I

    • B. 

      RNA Polymerase II

    • C. 

      Aminoacyl transferase

    • D. 

      RNA Polymerase III


  • 42. 
    Given the following sequence, how large (# amino acids) is the most likely eukaryotic polypeptide produced?                                       ACGAUGAGGAGGAUGGUCAAUGAUGCUGGCUGUUGAUAUUAACAU
    • A. 

      10

    • B. 

      7

    • C. 

      3

    • D. 

      4

    • E. 

      2


  • 43. 
    If the sequence of a nontemplate strand of DNA is 5’-ACCGCATCCGAGTCAC-3’, what is the sequence of the primary product of transcription?
    • A. 

      3’-UGGCGUAGGCUCACUG-5’

    • B. 

      3’-TGGCGTAGGCTCACTG-5’

    • C. 

      5’-ACCGCAUCCGAGUCAC-3’

    • D. 

      5’-ACCGCATCCGAGTCAC-3’

    • E. 

      None of the above


  • 44. 
    The genetic code is said to be “degenerate” because 
    • A. 

      There are more codons than amino acids.

    • B. 

      There are more amino acids than codons.

    • C. 

      Different organisms use different codons to encode the same amino acid.

    • D. 

      Some codons specify more than one amino acid.


  • 45. 
    When one speaks of a 5' cap, one is usually describing?
    • A. 

      Addition of a thymine to the 5’ end of an mRNA

    • B. 

      Addition of a guanine to the 3’ end of an mRNA

    • C. 

      Addition of a guanine to the 3’ end of an mRNA

    • D. 

      Addition of a guanine to the 5’ end of an mRNA

    • E. 

      None of the above


  • 46. 
    If the sequence of an RNA molecule is 5’-GGCAUCGACG-3’, what is the sequence of the template strand of DNA?
    • A. 

      5’-GGCATCGACG-3’

    • B. 

      3’-GGCATCGACG-5’

    • C. 

      5’-CCGTAGCTGC-3’

    • D. 

      3’-CCGTAGCTGC-5’

    • E. 

      None of the above


  • 47. 
    The primary structure of a protein is determined by
    • A. 

      The sequence of amino acids

    • B. 

      Hydrogen bonds formed between the components of the peptide linkage

    • C. 

      A series of helical domains

    • D. 

      Pleated sheets

    • E. 

      Covalent bonds formed between fibroin residues


  • 48. 
    In the absence of glucose, the CAP protein binds to a DNA sequence adjacent to the promoter of the lac operon.  Binding of CAP helps RNA polymerase to bind to the promoter and allows for a high level of transcription of the lac operon.  Regulation of the lac operon by the CAP protein is an example of
    • A. 

      Negative regulation

    • B. 

      Positive regulation

    • C. 

      Induction

    • D. 

      All allosteric effect

    • E. 

      Constitutive expression


  • 49. 
    Most genes in prokaryotes and eukaryotes are regulated primarily at which level of expression?
    • A. 

      Transcription

    • B. 

      MRNA stability

    • C. 

      RNA processing

    • D. 

      Protein activation

    • E. 

      Translation


  • 50. 
    Which element of the lac operon can act in cis or trans?
    • A. 

      Operator

    • B. 

      I gene

    • C. 

      Structural genes

    • D. 

      Promoter

    • E. 

      CAP-binding site


  • 51. 
    In catabolite repression of the lac operon, glucose affects most directly the
    • A. 

      Catabolite-activating protein

    • B. 

      Level of ATP

    • C. 

      Lac repressor

    • D. 

      Lac operator

    • E. 

      Level of cAMP


  • 52. 
    Which of the following statements about an animal bearing a somatic mutation is true?
    • A. 

      Some but not all of the animal's offspring will also carry the mutation.

    • B. 

      All of the animal's offspring will carry the mutation.

    • C. 

      Both the animal and its offspring will show the mutant trait.

    • D. 

      The animal but not its offspring can be affected by the mutation.

    • E. 

      None of the above


  • 53. 
    Which of the following is most likely to cause a frameshift mutation?
    • A. 

      Base analog

    • B. 

      Alkylating agent

    • C. 

      Intercalating agent

    • D. 

      Ionizing radiation

    • E. 

      UV light


  • 54. 
    Phosphorylation of pRB is carried out by?
    • A. 

      Cyclin D

    • B. 

      CDK4

    • C. 

      E2F

    • D. 

      CDK1/cyclin B

    • E. 

      CDK4/cyclin D


  • 55. 
    The term used to describe genes that are evolutionarily related is?
    • A. 

      Paralogs

    • B. 

      Orthologs

    • C. 

      Homologs

    • D. 

      None of the above

    • E. 

      All of the above


  • 56. 
    Homologous genes found in different species that evolved from a common ancestor are called?
    • A. 

      Paralogs

    • B. 

      Orthologs

    • C. 

      Related

    • D. 

      Duplications

    • E. 

      All of the above


  • 57. 
    Homologous genes in the same organism are called?
    • A. 

      Paralogs

    • B. 

      Orthologs

    • C. 

      Related

    • D. 

      Duplications

    • E. 

      All of the above


  • 58. 
    For most protein-encoding genes, the synonymous rate of change is:
    • A. 

      Considerably higher than the nonsynonymous rate

    • B. 

      Considerably lower than the nonsynonymous rate

    • C. 

      Equal to the nonsynonymous rate

    • D. 

      All of the above

    • E. 

      None of the above


  • 59. 
        ??      speciation arises in the absence of any geographic barrier to gene flow:
    • A. 

      Autocratic

    • B. 

      Allopatric

    • C. 

      Sympatric

    • D. 

      Parapatric

    • E. 

      Peripatric


  • 60. 
       ??       speciation is initiated by a geographic barrier to gene flow
    • A. 

      Autocratic

    • B. 

      Allopatric

    • C. 

      Sympatric

    • D. 

      Parapatric

    • E. 

      Peripatric


  • 61. 
    Which of the following must exist within a population before evolution can take place?
    • A. 

      Speciation

    • B. 

      Genetic variation

    • C. 

      Genetic drift

    • D. 

      All of the above

    • E. 

      None of the above


  • 62. 
    Which of the following statements is true:
    • A. 

      Evolution occurs in individuals, as well as in groups.

    • B. 

      Evolution occurs in groups.

    • C. 

      Evolution can be directly observed.

    • D. 

      B and C

    • E. 

      A and B


  • 63. 
    A wingless fruit fly is isolated from a population after exposure of the parental generation to EMS.  Eventually the mutation is shown to have occurred within the coding sequence of a gene that changes a 5’-GGC-3’ codon (encoding glycine) to a 5’-AGC-3’ codon (encoding serine).  Which term would not correctly describe this mutation?
    • A. 

      Transversion

    • B. 

      Induced

    • C. 

      Substitution

    • D. 

      Missence

    • E. 

      Loss-of-function


  • 64. 
    Which of the following groups of proteins is NOT commonly known to include oncogenes?
    • A. 

      Transcription factors

    • B. 

      Growth factors

    • C. 

      Signal-transduction proteins

    • D. 

      Ion channels

    • E. 

      DNA-repair enzymes


  • 65. 
    Which event is not normally associated with development of cancer?
    • A. 

      Inactivation of a tumor-suppressor gene in a cell

    • B. 

      Inactivation of a proto-oncogene in a cell

    • C. 

      Infection of a cell with a virus that carries an oncogene

    • D. 

      Chromosome rearrangements including insertions and deletions

    • E. 

      Activation of genes encoding telomerase in somatic cells


  • 66. 
    Typically, a small subset of genes are expressed in each type of cell within an organism.
    • A. 

      True

    • B. 

      False


  • 67. 
    Regulation of the lac operon of E. coli by lactose is both negative and inducible
    • A. 

      True

    • B. 

      False


  • 68. 
    In the absence of allolactose, the lac operon is constitutively transcribed.
    • A. 

      True

    • B. 

      False


  • 69. 
    In the absence of tryptophan, the genes of the trp operon are not expressed.
    • A. 

      True

    • B. 

      False


  • 70. 
    A purine’s being replaced by a different purine is called a transition mutation.
    • A. 

      True

    • B. 

      False


  • 71. 
    Frameshift mutations generally have more drastic effects on the phenotype than do substitutions.
    • A. 

      True

    • B. 

      False


  • 72. 
    Nonsense mutations do not alter DNA sequence information.
    • A. 

      True

    • B. 

      False


  • 73. 
    The presence of a single mutated gene is sufficient for retinoblastoma cancer to develop
    • A. 

      True

    • B. 

      False


  • 74. 
    Proto-oncogenes are found in normal, non-cancerous cells and are responsible for normal cell processes.
    • A. 

      True

    • B. 

      False


  • 75. 
    Proto-oncogenes cause cancer.
    • A. 

      True

    • B. 

      False


  • 76. 
    A eukaryotic promoter contains a Pribnow box
    • A. 

      True

    • B. 

      False


  • 77. 
    Introns are removed from precursor mRNAs by spliceosomes
    • A. 

      True

    • B. 

      False


  • 78. 
    During replication, primase adds an RNA primer to DNA.
    • A. 

      True

    • B. 

      False


  • 79. 
    Messenger RNA is usually polycistronic in eukaryotes
    • A. 

      True

    • B. 

      False


  • 80. 
    Proteins are composed of strings of nucleotides connected together by 5' - 3' phosphodiester bonds.
    • A. 

      True

    • B. 

      False


  • 81. 
    All RNAs are translated.
    • A. 

      True

    • B. 

      False


  • 82. 
    The codon for methionine appears only at the beginning of the mRNA for a protein, not in the middle or in the end.
    • A. 

      True

    • B. 

      False


  • 83. 
    Given an inheritance pattern of incomplete dominance and 81 flowers are red (R1R1), 18 flowers are pink (R1R2), and 1 flower is white (R2R2), the frequency of the R1 allele is 0.9.
    • A. 

      True

    • B. 

      False


  • 84. 
    The sugar ribose differs from deoxyribose by an OH group at the 5' C position 
    • A. 

      True

    • B. 

      False


  • 85. 
    G and U are present in both DNA and RNA
    • A. 

      True

    • B. 

      False


  • 86. 
    Chromosomal inversions result in duplications and deletions
    • A. 

      True

    • B. 

      False


  • 87. 
    An allopolyploid consists of more than 2 haploid sets of chromosomes, originating from the same species.
    • A. 

      True

    • B. 

      False


  • 88. 
    The ratio of (A+G) to (T+C) in a double-stranded DNA molecule is equal to 1
    • A. 

      True

    • B. 

      False


  • 89. 
    The ratio of (A+T) to (G+C) in a double-stranded DNA molecule is equal to 1
    • A. 

      True

    • B. 

      False


  • 90. 
    An individual heterozygous for d e f was crossed to a homozygous recessive individual (d/d e/e f/f).  The following offspring were recovered. +  +  +             39 +  e  f               372 d  +  f               7 d  e  f               47 +  e  +              5 d  +  +              412  What is the correct order of these genes?
    • A. 

      Def

    • B. 

      Edf

    • C. 

      Dfe


  • 91. 
    That some organisms contain much larger amounts of DNA than apparently "needed" and that some relatively closely related organisms may have vastly different amounts of DNA is more typical in
    • A. 

      Viruses than in bacteria.

    • B. 

      RNA viruses than in DNA viruses.

    • C. 

      Eukaryotes than in prokaryotes.

    • D. 

      The family "alphoid" rather than the diphloid family.

    • E. 

      Prokaryotes than in eukaryotes.


  • 92. 
    For any gene with multiple alleles, a diploid organism may have a maximum of ________ alleles for that locus.
    • A. 

      1

    • B. 

      2

    • C. 

      6

    • D. 

      10

    • E. 

      100


  • 93. 
    ) If purple (P) is dominant to white (p) and axial (A) is dominant to terminal (a), and in a cross of white, axial to purple, axial the ratio of offspring is   6/16 white, axial;       2/16 white, terminal;       6/16 purple, axial;       2/16 purple, terminal,                                     What is the genotype of the parents?
    • A. 

      PPAA X ppaa

    • B. 

      PpAa x PpAa

    • C. 

      PpAa X Ppaa

    • D. 

      PpAa X ppAa

    • E. 

      PPAA X PPAA


  • 94. 
    Mendel crossed purebred wrinkled, green-seeded plants with purebred round, yellow-seeded plants.  Round seeds are recessive to wrinkled, and yellow seeds are recessive to green. The F1 progeny were self-crossed.  Which of the following numbers are most likely to result from this cross.
    • A. 

      22 round, yellow; 26 round, green; 28 wrinkled, yellow, 24 wrinkled green

    • B. 

      91 round, yellow; 32 round, green; 30 wrinkled, yellow, 8 wrinkled green

    • C. 

      11 round, yellow; 26 round, green; 27 wrinkled, yellow, 87 wrinkled green

    • D. 

      64 round, yellow; 26 round, green; 27 wrinkled, yellow, 27 wrinkled green

    • E. 

      75 wrinkled, green; 25 round, yellow


  • 95. 
    An organism's complete set of genes is called its 
    • A. 

      Genotype

    • B. 

      Prototype

    • C. 

      Phenotype

    • D. 

      Ribotype

    • E. 

      Karyotype


  • 96. 
    Crossing over occurs most frequently during which stage of cell division? 
    • A. 

      Prophase I of meiosis

    • B. 

      Metaphase II of meiosis

    • C. 

      Prophase of mitosis

    • D. 

      Telophase of mitosis

    • E. 

      Prophase II of meiosis


  • 97. 
    The chromosome theory of inheritance states that 
    • A. 

      Chromosomes replicate before cell division.

    • B. 

      Alleles of a gene segregate during cell division.

    • C. 

      The chromosome theory of inheritance states that.

    • D. 

      Chromosomes are made of DNA.

    • E. 

      All of the above


  • 98. 
    At the conclusion of meiosis, there are ________ cells
    • A. 

      Two diploid

    • B. 

      Four diploid

    • C. 

      Two haploid

    • D. 

      Four haploid


  • 99. 
    In lilies, white flowers (W) are dominant to purple flowers (w).  If two plants that are heterozygous for flower color are mated, the offspring might have which genotype? 
    • A. 

      W W

    • B. 

      W w

    • C. 

      Ww

    • D. 

      All of the above

    • E. 

      None of the above


  • 100. 
    A person who is known to have a particular genotype does not show the phenotype specified by the gene. This is an example of 
    • A. 

      Incomplete dominance

    • B. 

      Epistasis

    • C. 

      Incomplete penetrance

    • D. 

      Phenotype switching

    • E. 

      Sex reversal


Back to top

Removing ad is a premium feature

Upgrade and get a lot more done!
Take Another Quiz
We have sent an email with your new password.