Biology Practice Test (Part 2)
Questions and Answers
- 1.
Which of the following has the greatest amount of kinetic energy?
- A.
Tank of gasoline
- B.
Flying bird
- C.
Parked car
- D.
Cool air surrounding the engine
Correct Answer
B. Flying birdExplanation
The flying bird has the greatest amount of kinetic energy because kinetic energy is the energy possessed by an object due to its motion. The bird is in motion while flying, therefore it has more kinetic energy compared to the other options. The tank of gasoline, parked car, and cool air surrounding the engine are not in motion, so they have less or no kinetic energy.Rate this question:
-
- 2.
Entropy is a measure of
- A.
Increase in orderliness
- B.
Gain of high-level energy
- C.
Increase in potential energy
- D.
Increase in kinetic energy
- E.
Increase in randomness
Correct Answer
E. Increase in randomnessExplanation
Entropy is a measure of the randomness or disorder in a system. As entropy increases, the system becomes more disordered and unpredictable. This is because there are more possible arrangements or configurations for the particles or components within the system. Conversely, as entropy decreases, the system becomes more ordered and predictable. Therefore, the correct answer is "increase in randomness".Rate this question:
-
- 3.
What is the ultimate source of energy for most forms of life on Earth?
- A.
Heat energy
- B.
Chemical energy
- C.
Thermal energy
- D.
Solar energy
- E.
Nuclear energy
Correct Answer
D. Solar energyExplanation
Solar energy is the ultimate source of energy for most forms of life on Earth. This is because sunlight is captured by plants through the process of photosynthesis, which converts solar energy into chemical energy in the form of glucose. This glucose is then used by plants as a source of energy for growth and development. Other organisms, such as herbivores and carnivores, obtain their energy by consuming plants or other animals that have obtained their energy from the sun. Therefore, solar energy is the primary source of energy that sustains life on Earth.Rate this question:
-
- 4.
What results if glucose is metabolized under completely anaerobic conditions?
- A.
Pyruvic acid immediately enters the Krebs cycle
- B.
Pyruvic acid is converted by fermentation into CO2 and ethanol or lactic acid
- C.
Pyruvic acid is converted back to fructose until the concentration of oxygen increases
- D.
Pyruvic acid leaves the fluid portion of the cytoplasm and enters the mitochondrial matrix
- E.
Pyruvic acid is converted to NADH
Correct Answer
B. Pyruvic acid is converted by fermentation into CO2 and ethanol or lactic acidExplanation
When glucose is metabolized under completely anaerobic conditions, pyruvic acid is converted by fermentation into either CO2 and ethanol or lactic acid. This is because in the absence of oxygen, the cells cannot undergo aerobic respiration and instead rely on fermentation to generate energy. Fermentation allows for the regeneration of NAD+ so that glycolysis can continue, producing either ethanol or lactic acid as byproducts depending on the organism.Rate this question:
-
- 5.
During glycolysis, what is the net gain of ATP molecules produced?
- A.
36
- B.
4
- C.
34
- D.
2
- E.
38
Correct Answer
D. 2Explanation
During glycolysis, which is the first step of cellular respiration, the net gain of ATP molecules produced is 2. This occurs through substrate-level phosphorylation, where a phosphate group is transferred from a substrate molecule to ADP, forming ATP. Glycolysis breaks down glucose into two molecules of pyruvate, and during this process, a total of 4 ATP molecules are produced. However, 2 ATP molecules are consumed in the initial steps of glycolysis, resulting in a net gain of 2 ATP molecules.Rate this question:
-
- 6.
Both plants and animals perform
- A.
Glycolysis
- B.
Fermentation
- C.
Krebs cycle
- D.
Photosynthesis
- E.
A, B and C are correct
Correct Answer
E. A, B and C are correctExplanation
Plants and animals both perform glycolysis, fermentation, and the Krebs cycle. Glycolysis is the initial step in cellular respiration, where glucose is broken down to produce energy. Fermentation is an anaerobic process that occurs when oxygen is not available, and it helps regenerate NAD+ for glycolysis to continue. The Krebs cycle, also known as the citric acid cycle, is the second stage of cellular respiration where acetyl-CoA is oxidized to produce ATP, NADH, and FADH2. Therefore, all three processes are essential for energy production in both plants and animals.Rate this question:
-
- 7.
Which of the following is an example of an electron carrier molecule?
- A.
Citric acid
- B.
CO2
- C.
Acetyl CoA
- D.
NAD
- E.
ATP
Correct Answer
D. NADExplanation
NAD (nicotinamide adenine dinucleotide) is an example of an electron carrier molecule. It plays a crucial role in cellular respiration by accepting and donating electrons during the process of energy production. NAD acts as a coenzyme, facilitating the transfer of electrons from one molecule to another, thus participating in various metabolic reactions.Rate this question:
-
- 8.
Chemiosmosis in mitochondria directly results in the synthesis of
- A.
NADH
- B.
FADH2
- C.
H2O
- D.
CoA
- E.
ATP
Correct Answer
E. ATPExplanation
Chemiosmosis in mitochondria is a process where ATP is synthesized. During this process, the electron transport chain pumps protons across the inner mitochondrial membrane, creating an electrochemical gradient. This gradient drives the movement of protons back into the mitochondrial matrix through ATP synthase, an enzyme that synthesizes ATP. As protons flow through ATP synthase, it catalyzes the addition of a phosphate group to ADP, forming ATP. Therefore, the correct answer is ATP.Rate this question:
-
- 9.
The most ATP is produces during which of the following processes
- A.
Glycolysis
- B.
Krebs Cycle
- C.
Electron transport chain
- D.
An equal amount of ATP is produced during each of the processes above
- E.
None of the answers are correct
Correct Answer
C. Electron transport chainExplanation
The electron transport chain is the process that produces the most ATP. This is because it is the final step in cellular respiration, where the majority of ATP is generated. During the electron transport chain, electrons from NADH and FADH2 are passed along a series of protein complexes, creating a proton gradient across the inner mitochondrial membrane. This gradient is then used by ATP synthase to produce ATP. In contrast, glycolysis and the Krebs cycle produce a smaller amount of ATP compared to the electron transport chain.Rate this question:
-
- 10.
Which of the following processes occur(s) in the cytoplasm?
- A.
Glycolysis
- B.
Krebs Cycle
- C.
ETC (electron transport chain)
- D.
Both A and B occur in the cytoplasm
- E.
All of the above occur in the cytoplasm
Correct Answer
A. GlycolysisExplanation
Glycolysis is the process of breaking down glucose into pyruvate molecules. It occurs in the cytoplasm of cells. The Krebs Cycle and the electron transport chain (ETC) occur in the mitochondria, not in the cytoplasm. Therefore, the correct answer is Glycolysis.Rate this question:
-
- 11.
What structural feature of a leaf allows a leaf to obtain CO2 from the air?
- A.
Stoma
- B.
Epidermis
- C.
Cuticle
- D.
Mesophyll
- E.
Chloroplast
Correct Answer
A. StomaExplanation
The stoma is the correct answer because it is the small opening found on the surface of the leaf that allows for gas exchange. It is through the stoma that the leaf is able to obtain carbon dioxide (CO2) from the air, which is necessary for photosynthesis to occur. The epidermis is the outermost layer of the leaf, the cuticle is the waxy layer that covers the leaf, the mesophyll is the tissue inside the leaf where photosynthesis takes place, and the chloroplasts are the organelles within the mesophyll cells where photosynthesis occurs. However, none of these structures directly allow for the leaf to obtain CO2 from the air.Rate this question:
-
- 12.
Specifically, molecules of chlorophyll are located in membranes of sacs called
- A.
Cristae
- B.
Thylakoids
- C.
Stoma
- D.
Lysosomes
- E.
Vesicles
Correct Answer
B. ThylakoidsExplanation
Thylakoids are the correct answer because they are membrane-bound sacs found in chloroplasts, where the molecules of chlorophyll are located. Thylakoids are responsible for carrying out the light-dependent reactions of photosynthesis, where chlorophyll absorbs light energy and converts it into chemical energy. This explanation aligns with the information provided in the question and accurately describes the relationship between chlorophyll and thylakoids.Rate this question:
-
- 13.
What factors influence the rate of photsynthesis?
- A.
Light intensity
- B.
Temperature
- C.
CO2
- D.
Water availability
- E.
All of these
Correct Answer
E. All of theseExplanation
All of these factors influence the rate of photosynthesis. Light intensity is important because it provides the energy needed for the process. Temperature affects the rate of photosynthesis because enzymes involved in the process have an optimal temperature range. CO2 is a necessary reactant for photosynthesis, and its availability affects the rate. Water availability is also crucial as it is needed for the transport of nutrients and for maintaining turgidity in plant cells, which is necessary for photosynthesis.Rate this question:
-
- 14.
The majority of the leaf’s chloroplasts are found in the mesophyll cells.
- A.
True
- B.
False
Correct Answer
A. TrueExplanation
The mesophyll cells are responsible for photosynthesis in plants, as they contain the majority of the leaf's chloroplasts. Chloroplasts are the organelles where photosynthesis takes place, and they contain the pigment chlorophyll that captures sunlight and converts it into energy. Therefore, it is true that the majority of the leaf's chloroplasts are found in the mesophyll cells.Rate this question:
-
- 15.
Light-dependent photosynthetic reactions produce
- A.
ATP, NADPH, O2
- B.
ATP, NADPH, CO2
- C.
Glucose, ATP, O2
- D.
Glucose, ATP, CO2
- E.
ATP, NADPH, H2O
Correct Answer
A. ATP, NADPH, O2Explanation
Light-dependent photosynthetic reactions occur in the thylakoid membrane of chloroplasts and involve the absorption of light energy by chlorophyll. This energy is used to produce ATP (adenosine triphosphate) and NADPH (nicotinamide adenine dinucleotide phosphate), which are energy-rich molecules. Additionally, these reactions also release oxygen (O2) as a byproduct. Therefore, the correct answer is ATP, NADPH, O2.Rate this question:
-
- 16.
During the process of photosynthesis, solar energy is converted into
- A.
Chemical energy
- B.
Heat energy
- C.
Thermal energy
- D.
Mechanical energy
- E.
Nuclear energy
Correct Answer
A. Chemical energyExplanation
During the process of photosynthesis, solar energy is absorbed by plants and converted into chemical energy. This energy is then stored in the form of glucose molecules, which can be used by the plant for growth, reproduction, and other metabolic processes. This conversion of solar energy into chemical energy is essential for the survival of plants and is the basis of the food chain, as other organisms rely on plants for energy. Heat, thermal, mechanical, and nuclear energy are not directly involved in the process of photosynthesis.Rate this question:
-
- 17.
In the lab, when observing the mesophyll cells of Alodea under the microscope, you saw many
- A.
Amyloplasts
- B.
Sphingoplasts
- C.
Chloroplasts
- D.
Leupoplasts
- E.
Teichoplast
Correct Answer
C. ChloroplastsExplanation
While observing the mesophyll cells of Alodea under the microscope, the presence of various organelles was noted. Among these organelles, the correct answer is "chloroplasts." Chloroplasts are responsible for photosynthesis in plant cells, where they convert sunlight into energy-rich molecules. The other options mentioned, such as amyloplasts, sphingoplasts, leucoplasts, and teichoplasts, are not involved in photosynthesis and do not play a role in capturing sunlight.Rate this question:
-
- 18.
Which of the following has potential energy?
- A.
Water droplet on top of a waterfall
- B.
Glucose molecule
- C.
Diver on a springboard
- D.
9V battery
- E.
All of the above
Correct Answer
E. All of the aboveExplanation
All of the given options have potential energy. The water droplet on top of a waterfall has potential energy due to its position in the Earth's gravitational field. The glucose molecule has potential energy stored in its chemical bonds. The diver on a springboard has potential energy due to their position above the ground. The 9V battery has potential energy stored in its chemical composition. Therefore, all of the options listed have the potential to do work or release energy in some form.Rate this question:
-
- 19.
In exergonic chemical reactions
- A.
Reactants have more energy than products
- B.
Energy is stored by the reactions
- C.
Reactants have less energy then products
- D.
Reactants and products possess equal amounts of energy
- E.
Both A and B are correct
Correct Answer
A. Reactants have more energy than productsExplanation
In exergonic chemical reactions, the reactants have more energy than the products. This means that the reactants are in a higher energy state compared to the products. During the reaction, energy is released, and the reactants undergo a decrease in energy to form the products. This is why exergonic reactions are often described as spontaneous or releasing energy.Rate this question:
-
- 20.
An _________ chemical reaction releases energy while an __________ reactions requires an input of energy
- A.
Exergonic; endergonic
- B.
Endergonic; exergonic
- C.
Enzymatic; endergonic
- D.
Endergonic; enzymatic
- E.
Equilibrium; exergonic
Correct Answer
A. Exergonic; endergonicExplanation
Exergonic reactions release energy, meaning that the products have less energy than the reactants. On the other hand, endergonic reactions require an input of energy, meaning that the products have more energy than the reactants. Therefore, the correct answer is exergonic; endergonic.Rate this question:
-
- 21.
Imagine you are conducting an experiment on a yeast enzyme known as sucrase This enzyme is used by yeast cells to break sucrose into glucose and fructose. What type of reaction is this?
- A.
Metergonic reaction
- B.
Exergonic reaction
- C.
Endergonic reaction
- D.
Spontaneous reaction
Correct Answer
B. Exergonic reactionExplanation
This reaction is an exergonic reaction because it releases energy. Sucrase breaks down sucrose into glucose and fructose, and this process releases energy.Rate this question:
-
- 22.
The most common energy carrier molecule of living organisms is
- A.
ATP
- B.
Inorganic phosphate
- C.
DNA
- D.
Glucose
- E.
GADPH
Correct Answer
A. ATPExplanation
ATP (adenosine triphosphate) is the most common energy carrier molecule in living organisms. It is responsible for storing and releasing energy for various cellular processes. ATP is composed of adenosine and three phosphate groups. When one phosphate group is removed from ATP, it releases energy, which can be used by cells for activities such as muscle contraction, active transport, and synthesis of molecules. In contrast, inorganic phosphate, DNA, glucose, and GADPH do not serve as energy carrier molecules in the same way as ATP does.Rate this question:
-
- 23.
All the following statements pertaining to catalysts are true EXCEPT
- A.
Enzymes are biological catalysts lacking specific activity
- B.
Biological catalysts decrease the activation energy
- C.
They (catalysts) increase reaction rate
- D.
Catalysts are not permanently altered during reaction
- E.
Catalysts can be used over and over again
Correct Answer
A. Enzymes are biological catalysts lacking specific activityExplanation
Enzymes are biological catalysts that have specific activity, meaning they are highly specialized in catalyzing specific reactions. This specificity allows enzymes to bind to specific substrates and convert them into products. Therefore, the statement that enzymes are biological catalysts lacking specific activity is incorrect.Rate this question:
-
- 24.
The reactant in an enzyme-catalyzed reaction is the
- A.
Activation energy
- B.
Active site
- C.
Product
- D.
Inhibitor
- E.
Substrate
Correct Answer
E. SubstrateExplanation
In an enzyme-catalyzed reaction, the reactant that undergoes a chemical transformation is called the substrate. Enzymes are specialized proteins that act as catalysts, increasing the rate of chemical reactions by lowering the activation energy required for the reaction to occur. The substrate binds to the active site of the enzyme, forming an enzyme-substrate complex. This allows the enzyme to facilitate the conversion of the substrate into the desired product. Therefore, the correct answer is substrate.Rate this question:
-
- 25.
Which of the following is part of the first law of thermodynamics
- A.
Energy cannot be created or destroyed
- B.
Kinetic energy is stored energy
- C.
Energy cannot be transferred or transformed
- D.
Exergonic reactions are coupled with endergonic reactions
- E.
Potential energy equals kinetic energy in a reaction
Correct Answer
A. Energy cannot be created or destroyedExplanation
The first law of thermodynamics, also known as the law of conservation of energy, states that energy cannot be created or destroyed, only converted from one form to another. This means that the total amount of energy in a closed system remains constant. This principle is fundamental in understanding energy transfer and transformation in various physical and chemical processes.Rate this question:
-
- 26.
Erythrpoietin (EPO) stimulates which of the following processes
- A.
NaCl uptake
- B.
Adjustment of the blood pH
- C.
White blood cell production
- D.
NaCl realease into the urine
- E.
Red blood cell production
Correct Answer
E. Red blood cell productionExplanation
Erythropoietin (EPO) is a hormone that stimulates the production of red blood cells in the body. Red blood cells are responsible for carrying oxygen to different parts of the body. Therefore, EPO plays a crucial role in maintaining the oxygen-carrying capacity of the blood. The other options listed, such as NaCl uptake, adjustment of blood pH, white blood cell production, and NaCl release into the urine, are not directly regulated by EPO.Rate this question:
-
- 27.
In the lactose lab exercise, the addition of the heated lactase enzyme to the milk did not change the pH because
- A.
The lactase did not have specificity for any substrates in the milk
- B.
When the lactase acted on the lactose in the milk, there was no anticipated change in the solution pH
- C.
The denatured lactase was biological inactive
- D.
Of the presence of the appropriate buffer solution in the milk
- E.
The color actually changed rapidly for a short period and the change in color disappeared immediately
Correct Answer
C. The denatured lactase was biological inactiveExplanation
The addition of the heated lactase enzyme to the milk did not change the pH because the denatured lactase was biologically inactive.Rate this question:
-
- 28.
The sequence of subunits in the DNA “backbone” is
- A.
–base—phosphate—base—phosphate—base—phosphate-
- B.
-phosphate—sugar—phosphate—sugar—phosphate—sugar-
- C.
–sugar—base—sugar—base—sugar—base—sugar—base-
- D.
-base—sugar—phosphate—base—sugar—phosphate-
- E.
–base—phosphate—sugar—base—phosphate—sugar-
Correct Answer
B. -phosphate—sugar—phosphate—sugar—phosphate—sugar-Explanation
The correct answer is "-phosphate—sugar—phosphate—sugar—phosphate—sugar-". This is because the DNA backbone consists of alternating sugar and phosphate molecules. The phosphate group is attached to the 5' carbon of one sugar molecule and the 3' carbon of the adjacent sugar molecule. The sugar molecule in DNA is deoxyribose, and the phosphate group is a phosphodiester bond. This alternating arrangement of sugar and phosphate molecules forms the backbone of the DNA molecule.Rate this question:
-
- 29.
Complementary base pairs are held together by
- A.
Peptide bonds
- B.
Hydrogen bonds
- C.
Disulfide bonds
- D.
Covalent bonds
- E.
Ionic bonds
Correct Answer
B. Hydrogen bondsExplanation
Complementary base pairs in DNA are held together by hydrogen bonds. These bonds form between specific pairs of nucleotides: adenine (A) pairs with thymine (T) and guanine (G) pairs with cytosine (C). Hydrogen bonds are relatively weak compared to covalent bonds, but they provide enough stability to maintain the structure of the DNA double helix. This allows for the replication and transcription of DNA, as well as the accurate transmission of genetic information.Rate this question:
-
- 30.
In the chromatography lab, you separated the spinach’s ------on a filter paper
- A.
Chromosomes
- B.
Ribosome
- C.
Pigments
- D.
RNA molecules
- E.
None of the above
Correct Answer
C. PigmentsExplanation
In the chromatography lab, the purpose is to separate different components of a mixture based on their solubility and affinity for the stationary phase. In this case, the question mentions that the spinach's something was separated on a filter paper. Chromatography is commonly used to separate pigments, such as chlorophyll, which are present in spinach. Therefore, the correct answer is pigments.Rate this question:
-
- 31.
If a bacterial protein has 30 amino acids, how many nucleotides are needed to code for it?
- A.
30
- B.
60
- C.
90
- D.
120
- E.
600
Correct Answer
C. 90Explanation
Each amino acid is coded for by a sequence of three nucleotides called a codon. Therefore, to code for a protein with 30 amino acids, we need 30 codons. Since each codon consists of three nucleotides, we need a total of 30 x 3 = 90 nucleotides to code for the protein.Rate this question:
-
- 32.
Pick the best choice for the following statement about DNA: Like a spiral staircase
- A.
Deoxyribose
- B.
Phosphate
- C.
Covalent bonds
- D.
Hydrogen bonds
- E.
Double helix A
Correct Answer
E. Double helix AExplanation
The correct answer is "Double helix A" because the statement "Like a spiral staircase" is referring to the structure of DNA, which is a double helix. The double helix structure is formed by two strands of DNA that are twisted together, resembling a spiral staircase. The other options, such as deoxyribose, phosphate, covalent bonds, and hydrogen bonds, are all components or types of bonds found within the DNA molecule, but they do not directly relate to the spiral staircase-like structure.Rate this question:
-
- 33.
When a cell divides
- A.
Each daughter cell receives a nearly perfect copy of the parent cell’s genetic information
- B.
Each daughter cell receives exactly half the genetic information in the parent cell
- C.
Each daughter cell receives the same amount of genetic information that was in the parent cell, but it has been altered
- D.
Genetic information is randomly parceled out to the daughter cells
- E.
None of the above are true
Correct Answer
A. Each daughter cell receives a nearly perfect copy of the parent cell’s genetic informationExplanation
During cell division, each daughter cell receives a nearly perfect copy of the parent cell's genetic information. This is because the genetic material is replicated before the cell divides, ensuring that each daughter cell receives an identical set of chromosomes. This process is crucial for maintaining genetic stability and ensuring the accurate transmission of genetic information from one generation to the next.Rate this question:
-
- 34.
When DNA polymerase is in contact with thymine in the parental strand, what does it add to the growing daughter strand?
- A.
Thymine
- B.
Cytosine
- C.
Guanine
- D.
Adenine
- E.
Uracil
Correct Answer
D. AdenineExplanation
When DNA polymerase is in contact with thymine in the parental strand, it adds adenine to the growing daughter strand. This is because adenine forms a complementary base pair with thymine. In DNA replication, the DNA polymerase synthesizes a new strand by adding nucleotides that are complementary to the bases in the parental strand. Thymine always pairs with adenine, while cytosine pairs with guanine. Therefore, when DNA polymerase encounters thymine in the parental strand, it adds adenine to the growing daughter strand.Rate this question:
-
- 35.
Semiconservative DNA replication means
- A.
The old DNA is completely broken down
- B.
The old DNA remains completely intact
- C.
A pairs with T and G pairs with C
- D.
Only A & C
- E.
Each new DNA molecule has half of the old one
Correct Answer
E. Each new DNA molecule has half of the old oneExplanation
Semiconservative DNA replication refers to the process in which each new DNA molecule formed during replication contains one strand from the original DNA molecule and one newly synthesized strand. This means that half of the old DNA molecule is conserved in each new DNA molecule, while the other half is newly synthesized. This process ensures the preservation of genetic information during DNA replication.Rate this question:
-
- 36.
The sequence of nitrogen-containing bases on one strand of DNA most directly determines the sequence of
- A.
Fatty acids in a fat molecule
- B.
Bases in a protein molecule
- C.
Sugars in a polysaccharide molecule
- D.
All the above choices are correct
- E.
Amino acids in a protein molecule
Correct Answer
E. Amino acids in a protein moleculeExplanation
The sequence of nitrogen-containing bases on one strand of DNA determines the sequence of amino acids in a protein molecule. This is because the DNA sequence is transcribed into mRNA, which is then translated into a sequence of amino acids during protein synthesis. The sequence of amino acids determines the structure and function of the protein.Rate this question:
-
- 37.
Which of these is found in RNA but NOT in DNA?
- A.
Adenine
- B.
Phosphate groups
- C.
Thymine
- D.
Uracil
- E.
Deoxyribose sugar
Correct Answer
D. UracilExplanation
Uracyl is found in RNA but not in DNA. RNA is a single-stranded molecule that contains uracil instead of thymine, which is found in DNA. Uracil replaces thymine in RNA and pairs with adenine during RNA synthesis. This difference in nucleotide composition is one of the key distinctions between RNA and DNA.Rate this question:
-
- 38.
The number of consecutive mRNA bases needed to specify an amino acid is
- A.
1
- B.
4
- C.
3
- D.
64
- E.
6
Correct Answer
C. 3Explanation
The number of consecutive mRNA bases needed to specify an amino acid is 3. This is because each amino acid is coded by a sequence of three mRNA bases called a codon. There are a total of 64 possible codons (4^3), which can code for the 20 different amino acids found in proteins, as well as the start and stop signals for protein synthesis. Therefore, three consecutive mRNA bases are required to accurately specify an amino acid.Rate this question:
-
- 39.
If the sequence of bases in a section of DNA is TAGGCTAA, what is the corresponding sequence of bases in mRNA?
- A.
ATCCGATT
- B.
TAGGCTAA
- C.
CGAAUCGG
- D.
AATCGGAT
- E.
AUCCGAUU
Correct Answer
E. AUCCGAUUExplanation
The corresponding sequence of bases in mRNA can be found by replacing each base in the DNA sequence with its complementary base in RNA. In DNA, adenine (A) pairs with thymine (T), guanine (G) pairs with cytosine (C), and vice versa. Therefore, in the given DNA sequence TAGGCTAA, the complementary RNA sequence would be AUCCGAUU.Rate this question:
-
- 40.
The process of copying genetic information from DNA to RNA is called
- A.
Translation
- B.
Transformation
- C.
Replication
- D.
Transcription
- E.
Polymerization
Correct Answer
D. TranscriptionExplanation
The process of copying genetic information from DNA to RNA is called transcription. During transcription, an enzyme called RNA polymerase binds to a specific region of DNA called the promoter and separates the DNA strands. It then uses one of the DNA strands as a template to synthesize a complementary RNA molecule. This RNA molecule is an exact copy of the DNA sequence, except that it contains uracil (U) instead of thymine (T). Transcription is an essential step in gene expression, as it allows the genetic information stored in DNA to be used for protein synthesis.Rate this question:
-
- 41.
The function of the promoter is to signal the RNA polymerase where to stop transcribing the DNA
- A.
True
- B.
False
Correct Answer
B. FalseExplanation
The given statement is false. The function of the promoter is to signal the RNA polymerase where to start transcribing the DNA, not where to stop. The promoter is a specific sequence of DNA that is located upstream of the gene being transcribed. It provides a binding site for the RNA polymerase, allowing it to recognize the start site for transcription and initiate the process.Rate this question:
-
- 42.
Which of the following molecules functions to transfer genetic information from the nucleus to the cytoplasm?
- A.
DNA
- B.
MRNA
- C.
TRNA
- D.
Proteins
- E.
Lipids
Correct Answer
B. MRNAExplanation
mRNA, or messenger RNA, functions to transfer genetic information from the nucleus to the cytoplasm. After transcription, mRNA carries the genetic code from DNA to the ribosomes in the cytoplasm, where it is used as a template for protein synthesis. This process is known as translation. mRNA acts as an intermediary molecule, carrying the instructions for protein synthesis from the nucleus, where the DNA is located, to the site of protein synthesis in the cytoplasm. Therefore, mRNA is responsible for transferring genetic information from the nucleus to the cytoplasm.Rate this question:
-
- 43.
The start codon can be the code for any of the 20 amino acids
- A.
True
- B.
False
Correct Answer
B. FalseExplanation
The start codon is a specific sequence of nucleotides that signals the beginning of protein synthesis. It is always the code for the amino acid methionine and not any of the other 20 amino acids. Therefore, the statement that the start codon can be the code for any of the 20 amino acids is false.Rate this question:
-
- 44.
The strand of the DNA molecule that is used to transcribe from is called the _______ strand
- A.
Primer strand
- B.
Safety strand
- C.
Nascent strand
- D.
Template strand
- E.
None of the above
Correct Answer
D. Template strandExplanation
The template strand is the correct answer because it is the strand of DNA that serves as a template for the synthesis of RNA during transcription. The RNA molecule is complementary to the template strand, with each nucleotide in the RNA being dictated by the corresponding nucleotide in the template strand. This process allows for the accurate transfer of genetic information from DNA to RNA.Rate this question:
-
- 45.
An anticodon is
- A.
3 consecutive nucleotides in tRNA
- B.
4 consecutive nucleotides in tRNA
- C.
The beginning of a DNA molecule
- D.
3 consecutive nucleotides in mRNA
- E.
3 consecutive amino acids in a protein
Correct Answer
A. 3 consecutive nucleotides in tRNAExplanation
An anticodon is a sequence of three nucleotides found on transfer RNA (tRNA) molecules. It is complementary to a specific codon on messenger RNA (mRNA) during protein synthesis. The anticodon ensures that the correct amino acid is brought to the ribosome during translation. Therefore, the correct answer is "3 consecutive nucleotides in tRNA".Rate this question:
-
- 46.
What kind of mutation occurs when one base is changed to another at a single location in the DNA
- A.
Insertion
- B.
Deletion
- C.
Translocation
- D.
Inversion
- E.
Substitution
Correct Answer
E. SubstitutionExplanation
A substitution mutation occurs when one base is changed to another at a single location in the DNA. This means that one nucleotide is replaced by a different nucleotide, which can result in a change in the amino acid sequence during protein synthesis. Substitution mutations can have different effects depending on the specific nucleotide change and its location within the DNA sequence.Rate this question:
-
- 47.
You have the following mRNA molecule. Given that the AUG is the start codon and the UGA Is the stop condon, indicate the number of aminoacids systhesized from this RNA molecle. 5’ AGGAUGCCCGGGCCCUGAUUG3’
- A.
21
- B.
7
- C.
6
- D.
5
- E.
4
Correct Answer
E. 4Explanation
The given mRNA molecule starts with the start codon AUG and ends with the stop codon UGA. The codons in between are UCC, CGG, GCC, GGG, CCC, UGA, and UUG. Each codon codes for one amino acid. Therefore, there are 4 amino acids synthesized from this RNA molecule.Rate this question:
-
- 48.
Allosterc sites of enzymes are the same as the active sites of the enzymes
- A.
True
- B.
False
Correct Answer
B. FalseExplanation
The statement is false because the allosteric sites of enzymes are different from the active sites of the enzymes. The active site is the specific region of the enzyme where the substrate binds and the chemical reaction takes place. On the other hand, the allosteric site is a different region of the enzyme where molecules other than the substrate can bind and regulate the enzyme's activity. These allosteric sites can either activate or inhibit the enzyme's function, and they are distinct from the active site.Rate this question:
-
- 49.
Enzyme activity is influenced by
- A.
PH
- B.
Temperature
- C.
Salt concentration
- D.
A & B only
- E.
A & B & C
Correct Answer
E. A & B & CExplanation
Enzyme activity is influenced by pH, temperature, and salt concentration. pH affects the ionization state of amino acid residues in the enzyme's active site, which can alter its activity. Temperature affects the rate of enzyme-catalyzed reactions, with higher temperatures generally increasing activity until a certain point where the enzyme denatures. Salt concentration can also affect enzyme activity by altering the ionic strength of the solution, which can impact the stability and conformation of the enzyme. Therefore, all three factors, pH, temperature, and salt concentration, can have an influence on enzyme activity.Rate this question:
-
- 50.
In the lactase lab, the lactose was present in the milk
- A.
True
- B.
False
Correct Answer
A. TrueExplanation
The lactase lab involved the presence of lactose in the milk. This suggests that the purpose of the lab was to test the enzyme lactase's ability to break down lactose. Lactose is a sugar found in milk, and lactase is the enzyme responsible for breaking it down into its component sugars, glucose and galactose. Therefore, it is logical to conclude that lactose was indeed present in the milk used in the lab.Rate this question:
-
Quiz Review Timeline +
Our quizzes are rigorously reviewed, monitored and continuously updated by our expert board to maintain accuracy, relevance, and timeliness.
-
Current Version
-
Mar 21, 2023Quiz Edited by
ProProfs Editorial Team -
Aug 17, 2010Quiz Created by
Nokee
How Well Do You Know Molecular Biology Techniques?
How Well Do You Know Molecular Biology Techniques?
Quiz: Test Your Knowledge on Human Biology - Chapter 7
Quiz: Test Your Knowledge on Human Biology - Chapter 7
Quiz: Test Your Knowledge On Cell Differentiation!
Quiz: Test Your Knowledge On Cell Differentiation!
- Aeronautics Quizzes
- Aerospace Quizzes
- Agricultural Science Quizzes
- Astrology Quizzes
- Astronomy Quizzes
- Atom Quizzes
- Biochemistry Quizzes
- Biomechanics Quizzes
- Biostatistics Quizzes
- Biotechnology Quizzes
- Botany Quizzes
- Branches Of Science Quizzes
- Chemistry Quizzes
- Cytology Quizzes
- Easy Science Quizzes
- Ecology Quizzes
- Electrical Quizzes
- Embryology Quizzes
- Endocrinology Quizzes
- Engineering Quizzes
- Environmental Science Quizzes
- Epidemiology Quizzes
- Experiment Quizzes
- Forestry Quizzes
- Fossil Quizzes
- Gas Quizzes
- General Science Quizzes
- Genetics Quizzes
- Histology Quizzes
- Human Biology Quizzes
- Integrated Science Quizzes
- Invention Quizzes
- Library Science Quizzes
- Lighting Quizzes
- Liquid Quizzes
- Marine Biology Quizzes
- Microbiology Quizzes
- Molecular Biology Quizzes
- Nature Quizzes
- Neuroscience Quizzes
- Nuclear Science Quizzes
- Oceanography Quizzes
- Physics Quizzes
- Psychology Quizzes
- Science And Technology Quizzes
- Science Glossary Quizzes
- Science Knowledge Quizzes
- Science Practice Quizzes
- Scientific Method Quizzes
- Scientific Notation Quizzes
- Soil Science Quizzes
- Solar System Quizzes
- Solid Quizzes
- Zoology Quizzes