The transcript will be an exact copy of the coding strand (ie, the one that starts with a start codon {ATG}), but the thymines (T) will be replaced with uracil (U).
Explanation
because there was a deletion that was not a multiple of 3 that resulted in a change of reading frame, this is a frameshift mutation.
Using the codon table, translate the triplet codes from the coding strand
Losing nucleotide #9 will alter the reading frame and result in new codons downstream of the mutation. Using the codon table, translate the new sequence (atgaatttaaagaattatttaatatcaat)
Nuc #9 is an A, and it is part of the codon TTA (leucine). If it is changed to a G, it will now generate a TTG codon (leucine). Since this mutation will still result in the addition of leucine, it is silent.