Quiz 10

Please wait...
Question 1 / 5
0 %
0/100
Score 0/100
1. Consider this DNA sequence.  What will its RNA transcript be?

Explanation

The transcript will be an exact copy of the coding strand (ie, the one that starts with a start codon {ATG}), but the thymines (T) will be replaced with uracil (U).

Submit
Please wait...
About This Quiz
Quiz 10 - Quiz

2. What type of mutation occurred in Question 4?

Explanation

because there was a deletion that was not a multiple of 3 that resulted in a change of reading frame, this is a frameshift mutation.

Submit
3. What is the protein sequence of the RNA transcript generated in Question 1?

Explanation

Using the codon table, translate the triplet codes from the coding strand

Submit
4. Another mutation occurs subsequently, and nucleotide number 9 is deleted entirely so the sequence is one base shorter overall.  What is the resulting protein sequence?

Explanation

Losing nucleotide #9 will alter the reading frame and result in new codons downstream of the mutation. Using the codon table, translate the new sequence (atgaatttaaagaattatttaatatcaat)

Submit
5. A mutation occurs in the DNA sequence from Question 1.  Nucleotide number 9 is now a "G".  What type of mutation is this?

Explanation

Nuc #9 is an A, and it is part of the codon TTA (leucine). If it is changed to a G, it will now generate a TTG codon (leucine). Since this mutation will still result in the addition of leucine, it is silent.

Submit
View My Results

Quiz Review Timeline (Updated): +

Our quizzes are rigorously reviewed, monitored and continuously updated by our expert board to maintain accuracy, relevance, and timeliness.

  • Current Version
  • Jan 24, 2013
    Quiz Edited by
    ProProfs Editorial Team
  • Apr 14, 2011
    Quiz Created by
Cancel
  • All
    All (5)
  • Unanswered
    Unanswered ()
  • Answered
    Answered ()
Consider this DNA sequence.  What will its RNA transcript be?
What type of mutation occurred in Question 4?
What is the protein sequence of the RNA transcript generated in...
Another mutation occurs subsequently, and nucleotide number 9 is...
A mutation occurs in the DNA sequence from Question 1. ...
Alert!

Advertisement