Genetics Hardest Test! Quiz Questions! Trivia

111 Questions | Total Attempts: 33

SettingsSettingsSettings
Genetics Hardest Test! Quiz Questions! Trivia - Quiz

Do you have enough knowledge to pass these genetics hardest test quiz questions? Two people share almost all their genetic material with a 0. 1 difference when analyzed in most cases, and as a genetics student, it is important to know what makes one person’s DNA different from the other. Test out your understanding when it comes to genes by taking this exciting quiz, feel free to take it as many times s possible.


Questions and Answers
  • 1. 
    How are eukaryotic polymerases different from bacterial polymerases.
  • 2. 
    How many tandem repeats in the CTD of RNAPII in yeast?
  • 3. 
    How many tandem repeats in the CTD of RNAPII in humans?
  • 4. 
    How many tandem repeats in the CTD of RNAPII in drosophila?
  • 5. 
    What happens if half of all the tandem repeats of a CTD are removed?
  • 6. 
    Where are 'Enhancers' located?
  • 7. 
    Where are 'Proximal promoter elements' located?
  • 8. 
    Which of the three genes located above are likely to encode a repressor?
  • 9. 
    During an experiment carried out in a strain of Bacillus subtilis that had had its own endogenous lacZ gene deleted from the chromosome.  Why is it important in promoter probe experiments like this to remove the endogenous lacZ gene?
  • 10. 
       A     T     C    G            1    2In the picture above, taken from a primer extension reaction, Where does translation start?ATCCCTATCCTGTCTATAAGTAGGGTTGGCCCTAT
  • 11. 
       A     T     C    G            1    2In the picture above, taken from a primer extension reaction, from a wild-type strain (1) and a strain where the operator sequence for the operon of interest has been deleted (2).   Do you think this gene is regulated by a repressor or an activator? Why?
  • 12. 
    Which promoter is responsible for the increase in relA expression as cells begin to enter stationary phase?
  • 13. 
  • 14. 
  • 15. 
    The product of gene expression can be ___________ in many of the steps before gene assembly / conformation.
  • 16. 
    RNA Polymerase I is...
    • A. 

      Inhibited by a-amanitin

    • B. 

      Only inhibited by small amounts of a-amanitin

    • C. 

      Only inhibited by large amounts of a-amanitin

    • D. 

      Insensitive to a-amanitin

  • 17. 
    RNA Polymerase II is...
    • A. 

      Inhibited by a-amanitin

    • B. 

      Only inhibited by small amounts of a-amanitin

    • C. 

      Only inhibited by large amounts of a-amanitin

    • D. 

      Insensitive to a-amanitin

  • 18. 
    RNA Polymerase III is...
    • A. 

      Inhibited by a-amanitin

    • B. 

      Only inhibited by small amounts of a-amanitin

    • C. 

      Only inhibited by large amounts of a-amanitin

    • D. 

      Insensitive to a-amanitin

  • 19. 
    RNA Polymerase I synthesises
    • A. 

      Ribosomal RNA (rRNA)

    • B. 

      Messenger RNA (mRNA)

    • C. 

      Transport RNA (tRNA

  • 20. 
    RNA Polymerase II synthesises
    • A. 

      Ribosomal RNA (rRNA)

    • B. 

      Messenger RNA (mRNA)

    • C. 

      Transport RNA (tRNA

  • 21. 
    RNA Polymerase III synthesises
    • A. 

      Ribosomal RNA (rRNA)

    • B. 

      Messenger RNA (mRNA)

    • C. 

      Transport RNA (tRNA

  • 22. 
    The 5s ribosome subunit is synthesised by which RNA polymerase?
    • A. 

      RNAP I

    • B. 

      RNAP II

    • C. 

      RNAP III

  • 23. 
    Roeder discovered RNA polymerase through experiments with which eukaryotic organism?______________
  • 24. 
    Chambon discovered RNA polymerase through experiments with which eukaryotic organism?_______________
  • 25. 
    Chambon and Roeder discovered the three RNA polymerases through which experimental technique?_________________
Related Topics
Back to Top Back to top