Bioethics Final Exam
.jpg "Bioethics Final Exam - Quiz")
- 1.
The fact that human genes inserted into bacteria produce proteins shows that the basic mechanisms of gene expression are different in bacteria and humans
- A.
True
- B.
False
Correct Answer
B. False -
- 2.
Bacterial cells that have been transformed with a plasmid that carries a genetic marker for resistance to the antibiotic tetracycline will not survive in a culture treated with tetracycline
- A.
True
- B.
False
Correct Answer
B. False -
- 3.
To produce a recombinant plasmid, the plasmid and the foreign DNA are cut with a different restriction enzyme
- A.
True
- B.
False
Correct Answer
B. False -
- 4.
Scientists use genetic markers to determine which cells have been successfully transformed
- A.
True
- B.
False
Correct Answer
A. True -
- 5.
Which of the following includes all others
- A.
Plasmid
- B.
Transformed bacterium
- C.
Foreign gene
- D.
Recombinant DNA
Correct Answer
B. Transformed bacterium -
- 6.
Bt crops have an additional gene that allows them to
- A.
Produce a natural herbicide
- B.
Produce a natural insecticide
- C.
Be disease free
- D.
To retain more water
Correct Answer
B. Produce a natural insecticide -
- 7.
A gene that makes it possible to distinguish bacteria that carry a plasmid containing foreign DNA from those that don't is called a(n)
- A.
Resistance gene
- B.
Antibiotic
- C.
Genetic marker
- D.
Clone
Correct Answer
C. Genetic marker -
- 8.
During transformation
- A.
A prokaryote is changed into a eukaryote
- B.
A bacterium takes in a plasmid
- C.
Foreign DNA is inserted into a plasmid
- D.
A cell is mutated
Correct Answer
B. A bacterium takes in a plasmid -
- 9.
Round-up ready crops contain
- A.
Round-up herbicide
- B.
A gene for round-up resistance
- C.
A natural herbicide
- D.
A natural insecticide
Correct Answer
B. A gene for round-up resistance -
- 10.
The process of making changes in the DNA code of living organisms is called
- A.
Selective breeding
- B.
Genetic engineering
- C.
Inbreeding
- D.
Hybridization
Correct Answer
B. Genetic engineering -
- 11.
Plasmids are naturally found in some
- A.
Humans
- B.
Plants
- C.
Bacteria
- D.
Viruses
Correct Answer
C. Bacteria -
- 12.
A transgenic organism that has extra copies of a gene produces more of the ___ that is coded for by that gene
- A.
DNA
- B.
Protein
- C.
Cell
- D.
Codons
Correct Answer
B. Protein -
- 13.
Why do transgenic bacteria that have the gene for human insulin produce insulin in great abundance
- A.
Because they use the gene more effectively than human cells do
- B.
Bacteria have special enzymes that allow them to produce more proteins, quicker
- C.
Bacteria reproduce to create many offspring that will also produce insulin
- D.
Bacteria are very large, so they can produce many proteins
Correct Answer
B. Bacteria have special enzymes that allow them to produce more proteins, quicker -
- 14.
Attempts to correct genetic defects in the sperm the egg, or a very early embryo would be classified as
- A.
Somatic cell gene therapy (or somatic cell engineering)
- B.
Germline engineering (or germline gene therapy)
- C.
Preimplantation genetic diagnosis
- D.
In-vitro fertilization
Correct Answer
B. Germline engineering (or germline gene therapy) -
- 15.
A recombinant plasmid gets inside a bacterial cell by
- A.
Inducing mutations
- B.
Injecting itself into the cell
- C.
Transformation
- D.
Recombining with the cell
Correct Answer
C. Transformation -
- 16.
What kind of techniques do scientists use to make transgemic organisms
- A.
Hybridization
- B.
Inbreeding
- C.
Inducing of mutations
- D.
Genetic engineering
Correct Answer
D. Genetic engineering -
- 17.
How many pieces of DNA will be produced if the following DNA is digested with the restriction enzyme EcoRI? EcoRI-- 5' G-AATTC 3' 5' ACG ACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3'TGC TGCATAATCTTAAGAATA GGCGGCGGCCTTAAGAGTAGT 5'
- A.
2
- B.
3
- C.
4
- D.
5
Correct Answer
B. 3 -
- 18.
Transgenic animals are animals that
- A.
Contain genes from a foreign species
- B.
Have recombinant DNA
- C.
Are genetically engineered
- D.
All of the above
Correct Answer
D. All of the above -
- 19.
Which of the following is a GMO
- A.
A transgenic plant
- B.
A goat that produces human proteins
- C.
A cow with recombinant DNA
- D.
All of the above
Correct Answer
D. All of the above -
- 20.
Many ethicists argue that germline genetic modifications many be more ethically problematic than other forms of genetic modification because
- A.
They affect somatic cells
- B.
They effects are multigenerational
- C.
It could alter human evolution
- D.
Both b and c
- E.
All of the above
Correct Answer
D. Both b and c -
- 21.
What is an advantage of using transgenic bacteria to produce human proteins
- A.
The human proteins produced by transgenic bacteria work better than those produced by humans
- B.
Transgenic bacteria can produce human proteins in large amounts
- C.
The human proteins produced by transgenic bacteria last longer than those produced by humans
- D.
Transgenic bacteria can produce human proteins used to make plastics
Correct Answer
B. Transgenic bacteria can produce human proteins in large amounts -
- 22.
A DNA molecule produced by combining DNA from different sources is known as
- A.
A mutant
- B.
A hybrid
- C.
A polyploid
- D.
Recombinant DNA
Correct Answer
D. Recombinant DNA -
- 23.
Why does the human insulin gene produce the same protein in humans and in transgenic bacteria
- A.
All organisms use genes in the same way
- B.
Gene expression is the same in all organisms
- C.
The same insulin gene is found in both humans and transgenic bacteria
- D.
All of the above
Correct Answer
D. All of the above -
- 24.
Suppose a bacterial culture were mixed with recombinant plasmids containing a gene for resistance to penicillin. the bacterial culture was then treated with penicillin. which of the following statements is NOT true?
- A.
Those bacteria that contain the plasmid will survive
- B.
The penicillin will kill the bacteria that were transformed
- C.
The gene for antibiotic resistance is expressed in the bacteria that survive
- D.
Those bacteria that are successfully transformed will survive
Correct Answer
B. The penicillin will kill the bacteria that were transformed -
- 25.
Bt crops contain a gene from
- A.
A virus
- B.
A plant
- C.
A type of bacteria
- D.
A beta tetracycline
Correct Answer
C. A type of bacteria -
- 26.
Which of the following is often used as a genetic marker in plasmids
- A.
A foreign gene
- B.
A gene for antibiotic resistance
- C.
A DNA sequence that serves as a bacterial origin of replication
- D.
A nucleotide labeled with a fluorescent dye
Correct Answer
B. A gene for antibiotic resistance -
- 27.
Which of the following is most commonly used as a vector in gene therapy
- A.
A transgene
- B.
A bacterium
- C.
A virus
- D.
A GMO
Correct Answer
C. A virus -
- 28.
Which of the following could be seen as a possible eugenics movement
- A.
Germline genetic engineering
- B.
Somatic cell genetic engineering
- C.
Both
- D.
Neither
Correct Answer
A. Germline genetic engineering -
- 29.
The introduction of healthy, therapeutic genes in attempts to correct a genetic disease or disorder is
- A.
Transgenic
- B.
Gene therapy
- C.
Gene splicing
- D.
Electrophoresis
Correct Answer
B. Gene therapy -
- 30.
Transgenic goats have been produced that have the ability to produce
- A.
Salt
- B.
Spiders
- C.
Spider silk
- D.
Human hair
Correct Answer
C. Spider silk -
- 31.
A SCIDs (severe combined immunodeficiency) patient has recently made a decision to participate in a clinical research trial in which he will recieve a therapeutic gene in attempts to regain immune function. this is an example of
- A.
Somatic cell gene therapy
- B.
Germline gene therapy
- C.
Preimplantation genetic diagnosis
- D.
Hormone injection
Correct Answer
A. Somatic cell gene therapy -
- 32.
During DNA replication, only one strand of DNA serves as a template.
- A.
True
- B.
False
Correct Answer
B. False -
- 33.
Genes determine a person's eye color by coding for nitrogenous bases that affect eye color.
- A.
True
- B.
False
Correct Answer
B. False -
- 34.
If a nucleic acid contains uracil, it is DNA
- A.
True
- B.
False
Correct Answer
B. False -
- 35.
A codon consists of four nucleotides
- A.
True
- B.
False
Correct Answer
B. False -
- 36.
DNA codes for DNA polymerase
- A.
True
- B.
False
Correct Answer
A. True -
- 37.
The anticodon AGA is complementary to the codon TCT
- A.
True
- B.
False
Correct Answer
B. False -
- 38.
Frameshift mutations cause greater damage to proteins than other types of mutations
- A.
True
- B.
False
Correct Answer
A. True -
- 39.
Insertions and substitutions usually cause frameshift mutations
- A.
True
- B.
False
Correct Answer
B. False -
- 40.
The human genome project determined the nucleotide sequence for all three billion base pairs in the human genome
- A.
True
- B.
False
Correct Answer
A. True -
- 41.
Before the Human Gemone Project, it was throught that there was only 30,000 genes in the human gemone; now because of the HGP we know that there are over 100,000 genes
- A.
True
- B.
False
Correct Answer
B. False -
- 42.
Genes contain instructions for assembling
- A.
Purines
- B.
Nucleosomes
- C.
Proteins
- D.
Pyrimidines
Correct Answer
C. Proteins -
- 43.
RNA contains the sugar
- A.
Ribose
- B.
Deoxyribose
- C.
Glucose
- D.
Lactose
Correct Answer
A. Ribose -
- 44.
Unlike DNA, RNA contains
- A.
Adenine
- B.
Uracil
- C.
Phosphate groups
- D.
Thymine
Correct Answer
B. Uracil -
- 45.
How many main types of RNA are there?
- A.
1
- B.
3
- C.
Hundreds
- D.
Thousands
Correct Answer
B. 3 -
- 46.
Which of the following are found in both DNA and RNA
- A.
Ribose, phosphate groups, and adenine
- B.
Deoxyribose, phosphate groups, and guanine
- C.
Phosphate groups, guanine, and cytosine
- D.
Phosphate groups, guanine, and thymine
Correct Answer
C. Phosphate groups, guanine, and cytosine -
- 47.
What is produced during transcription
- A.
RNA molecules
- B.
DNA molecules
- C.
RNA polymerase
- D.
Proteins
Correct Answer
A. RNA molecules -
- 48.
How many mRNA codons are needed to specify three amino acids
- A.
3
- B.
6
- C.
9
- D.
12
Correct Answer
A. 3 -
- 49.
What happens during the process of translation
- A.
Messenger RNA is made form DNA
- B.
The cell uses information from messenger RNA to produce proteins
- C.
Transfer RNA is made form messenger RNA
- D.
Copies of DNA molecules are made
Correct Answer
B. The cell uses information from messenger RNA to produce proteins -
- 50.
The order of nitrogenous bases in DNA determines the order of ___ in proteins
- A.
Nucleotides
- B.
Amino acids
- C.
Genes
- D.
Base pairs
Correct Answer
B. Amino acids -
Quiz Review Timeline +
Our quizzes are rigorously reviewed, monitored and continuously updated by our expert board to maintain accuracy, relevance, and timeliness.
-
Current Version
-
Feb 15, 2013Quiz Edited by
ProProfs Editorial Team -
May 02, 2012Quiz Created by
Gillmikaela
- Anatomy Quizzes
- Bacteria Quizzes
- Bio Quizzes
- Biological Evolution Quizzes
- Biology Exam Quizzes
- Biology Test Quizzes
- Cell Quizzes
- Cell Biology Quizzes
- Chapters Of Biology Quizzes
- Classical Conditioning Quizzes
- Conservation Biology Quizzes
- Enzyme Quizzes
- Fungi Quizzes
- General Biology Quizzes
- Genetics Quizzes
- Immunology Quizzes
- Macromolecule Quizzes
- Marine Biology Quizzes
- Microbiology Quizzes
- Mitosis And Meiosis Quizzes
- Molecular Biology Quizzes
- Parasitology Quizzes
- Physiology Quizzes
- Prokaryote Quizzes
- Protist And Fungi Quizzes
- Protozoa Quizzes
- Respiratory Quizzes
- Spine Quizzes
- Stem Cell Quizzes
- Taxonomy Quizzes
- Traits Quizzes
- Ultimate Biology Quizzes
- Virus Quizzes
- Zoology Quizzes
Back to top