Biochem Review
Settings
-
+
All the questions from Dan Yang
- 1.Which one of the following procceses do bacteria use to protect against restriction endonuclease activity?
- A.
Acetylation
- B.
Hydroxylation
- C.
Amination
- D.
Methylation
- E.
Carboxylation
- 2.Which of the following statements is correct regarding buffer strength at pH = 7.3 (MOPS:pK=7.2; SHS:pK=5.5)?
- A.
MOPS is more effective against both acid and base
- B.
None of the Rest
- C.
MOPS is more effective against base and SHS is more effective against acid
- D.
MOPS is more effective against acid and SHS is more effective against base
- E.
SHS is more effective against both acid and base
- 3.In gel electrophoresis of DNA, the fragment that travels the furthest is the __________.
- A.
Least non-polar
- B.
Medium size
- C.
Most polar
- D.
Largest
- E.
Smallest
- 4.The amino group of glycine can exist either in the protonated form (-NH3+) or ast the free base (-NH2). In order to have 99% of the glycine in its protonated form, what must be the numerical relation be between the pH of the solution and the pKa of the amino group of glycine?
- A.
PH-pKa = 1
- B.
PH-pKa = 2
- C.
PH-pKa = 0
- D.
PH-pKa = -1
- E.
PH-pKa = -2
- 5.Which of the following primers can amplify the following DNA segment by PCR? GACTGGTCGCGGATAGCGTATAATATTTCGGAATACGGTATACCCGGATACGGATA
- A.
5'CTGACCAGCGCC and 5'GACTGGTCGCGG
- B.
5'ATAGGCATAGGC and 5'CCGCGACCAGTC
- C.
5'ATAGGCATAGGC and 5'TATCCGTATCCG
- D.
5'ATAGGCATAGGC and 3'CTGACCAGCGCC
- E.
5'TATCCGTATCCG and 3'GGCGCTGGTCAG
- 6.Indicate the ionic species that predominate at pH 8 I: HCO3(-) II: Succinate(-1) III: H2CO3 IV: Succinate(-2) V: CO3(-2) VI: Succinic acid
- A.
III & V
- B.
I & V
- C.
I & IV
- D.
II & III
- E.
III & V
- 7.Which of the following statements is correct?
- A.
A spontaneous process can proceed spontaneously in the reverse direction with an appropriate change in reaction condition(s).
- B.
none of the statements
- C.
A reaction is said to be spontaneous when it can proceed in either the forward or reverse direction.
- D.
A spontaneous process can occur only if there is a large increase in entropy.
- E.
A spontaneous process always happens very quickly
- 8.Indicate the ionic species that predominate at pH 3 I: Succinate(-2) II: CO3(-2) III: Succinic acid IV: H2CO3 V: Succinate(-1) VI: HCO3(-)
- A.
II & V
- B.
III & IV
- C.
I & IV
- D.
II & III
- E.
III & VI
- 9.Which of the following lists is the best choice of buffers for pH 3.8, 6.1 and 8.1 respectively?
- A.
Succinic, Tris and HEPES
- B.
HEPES, Phosphoric acid and Ammonia
- C.
Formic, MES, Tris
- D.
Succinic, HEPES and Ammonia
- E.
Tris, Succinic and Ammonia
- 10.Which of the followings is not likely to cause problem in a PCR experiment?
- A.
the temperature of the reaction mixture stayed constant all the time
- B.
both primers are complementary to several sites in the starting DNA sample
- C.
Both primers are inadvertently omitted from the reaction mixture
- D.
there are two single-stranded breaks in one strand of the template DNA molecule
- E.
there is a double-stranded break in the template DNA molecule
- 11.A phosphodiester bond links which carbons together on the ribose backbone?
- A.
4' to 2'
- B.
6' to 1'
- C.
5' to 3'
- D.
3' to 2'
- E.
3' to 4'
- 12.What is the effective buffering range of HEPES?
- A.
7.1-9.1
- B.
6.2-8.2
- C.
6.5-8.5
- D.
3.5-11.5
- E.
1.5-3.5
- 13.The volume of a solution of 1 M NaOH that must be added to adjust the pH from 4 to 9 in 20mL of a 100 mM solution of phosphoric acid is:
- A.
1mL
- B.
2mL
- C.
3mL
- D.
4mL
- E.
5mL
- 14.Which of the following DNA sequences is palindromic?
- A.
ACGATCGT
- B.
AGATTACA
- C.
ACTAATGA
- D.
AGATTAGA
- E.
CGATTTGC
- 15.Which of the following restriction enzymes produce blunt ends (see Table 2)?
- A.
BamHI, HaeIII, PvuII, AluI
- B.
EcoRV, EcoRI, HaeIII, PvuII
- C.
AluI, PvuII, BglI, EcoRV
- D.
PvuII, EcoRV, HaeIII, AluI
- E.
All of the rest
- 16.The pH of a 100 mL solution containing 1 mL of 10 mM SHS, 1 mL of 10 mM MOPS and 20mL of 500mM HCL is (MOPS:pK=7.2; SHS:pK=5.5):
- A.
1.0
- B.
1.5
- C.
2.0
- D.
2.5
- E.
3.0
- 17.Which of the following restriction enzymes produce identical sticky ends (see Table 2)?
- A.
BamHI and BglII
- B.
HpaII and XhoI
- C.
SalI and TaqI
- D.
All of the answer pairs
- E.
None of the rest
- 18.Select the answer that arranges bond strength from strongest to weakest :
- A.
Van der Waals, ionic, hydrogen bonds, covalent
- B.
Ionic, covalent, hydrogen, van der Waals
- C.
Van der Waals, hydrogen bonds, ionic, covalent
- D.
Covalent, ionic, hydrogen bonds, van der Waals
- E.
None of the rest
- 19.DNA pol I can sequentially add deoxynucleotides to the ____ end of polynucleotides.
- A.
1'
- B.
2'
- C.
3'
- D.
5'
- E.
None of the rest
- 20.Which of the following is always true concerning the base composition of DNA?
- A.
In each single strand, the number of A = G
- B.
In a molecule of double stranded DNA, A + C = T + G
- C.
In a molecule of double stranded DNA, the number of A + T = C + G
- D.
In each single strand, the number of A = T
- E.
None of the rest
- 21.
- A.
1' carbon
- B.
2' carbon
- C.
3' carbon
- D.
5' carbon
- E.
None of the rest
- 22.Which of the following is not found in DNA
- A.
Uracil
- B.
Guanine
- C.
Cytosine
- D.
Adenine
- E.
Thymine
- 23.
- A.
100/101
- B.
1/11
- C.
10/11
- D.
1/101
- E.
1/1
- 24.Saquinavir is an antiretroviral that binds to HIV-I protease. Which of the following is true about HIV-I protease?
- A.
It is an aspartic protease with a catalytic Glu25-Gln26-His-27 active site.
- B.
It is a serine protease with a catalytic Asp32-His64-Ser-221 active site.
- C.
It is an aspartic protease with a catalytic Asp25-Thr26-Gly27.
- D.
It catalyzes the fusion of non-functional viral proteins into functional polyproteins.
- E.
None of the above.
- 25.Large doses of Saquinavir are necessary to inhibit HIV-I Protease because:
- A.
It is highly soluble in water and is excreted quickly in urine.
- B.
It is insoluble in water and must be taken with high fat foods, or it is not absorbed efficiently into the bloodstream.
- C.
It does not bind to blood plasma proteins and therefore cannot access infected lymphocytes.
- D.
It is not metabolized into an active form fast enough, so most of the dose is excreted.
- E.
None of the above
- 26.Which of the following statements about protein length is NOT true?
- A.
Synthetic efficiency determines the upper limit on length
- B.
3D structure stability determines the lower limit on length
- C.
5 residues is a lower limit, peptides start to fold after forming polymers of this length
- D.
All of the above are true
- E.
Two of the above are true
- 27.PYMOL is:
- A.
Software for visualizing molecules
- B.
Software for calculating force fields and minimizing molecular potential energy
- C.
Software for simulating molecular interactions using ligand double-shell and full flesh
- D.
All of the above
- E.
Two of the above are true
- 28.
- A.
ATP-binding site
- B.
Substrate Binding Site
- C.
All of the above
- D.
None of the above but somewhere on Bcr-Abl
- E.
Imatinib targets the Bcr-Abl gene
- 29.The BCR-ABL fusion oncogene is formed due to:
- A.
A random point mutation
- B.
A chromosomal translocation
- C.
An extra chromosome 21
- D.
All of the above
- E.
None of the above
- 30.
- A.
Traditional NSAID use can lead to cardiovascular disorders
- B.
NSAID use can lead to gastrointestinal disorders
- C.
NSAIDs are very lipid soluble but not water soluble
- D.
NSAIDs are very water soluble but not lipid soluble
- E.
NSAIDs are too specific in the enzymes that they inhibit
- 31.Which of the following functional groups are present on COX-2 inhibiting benzopyrans?
- A.
–CF3, –COOH
- B.
–BH2, –COOH
- C.
–SO3, –BH2
- D.
–CF3, –NH2
- E.
–SO3, –NH2
- 32.Which of the following statements is not true about neuraminidase?
- A.
Its major role is to the spread infection by releasing virions.
- B.
It is a tetrameric surface glycoprotein antigen.
- C.
It degrades the layer of mucus in the gastrointestinal tract.
- D.
Zanamivir and oseltamivir are two inhibitors used to counteract neuraminidase.
- E.
None of the above.
- 33.Which active sites on neuraminidase interact with its inhibitors?
- A.
Arginine 292 and glutamate 119
- B.
Glycine 129 and arginine 292
- C.
Valine 31 and glutamate 119
- D.
Alanine 292 and glutamine 119
- E.
Glycine 129 and valine 31
- 34.
- A.
DNA Binding
- B.
3’-processing
- C.
Nuclear Translocation and Import
- D.
Strand transfer
- E.
Gap repair
- 35.Which of the following is not correct regarding the catalytic core domain (CCD) of the HIV-1 integrase?
- A.
It contains three acidic residues
- B.
It coordinates two essential magnesium ions
- C.
It contains a nuclear localization signal used to import viral cDNA into the nucleus
- D.
It is responsible for stabilizing folding of the protein
- E.
It is a highly conserved region of HIV-1 integrase
- 36.The inhibition of factor IXa by benzothiophene prevents the activation of which factor in the coagulation cascade?
- A.
Factor VIII
- B.
Factor VIIIa
- C.
Factor IX
- D.
Factor X
- E.
Factor Xa
- 37.Factor IX is a zymogen. This means that factor IX is
- A.
An inactive enzyme precursor
- B.
Made of a single polypeptide chain
- C.
A serine protease
- D.
Part of the intrinsic pathway
- E.
A gene on the X-chromosome
- 38.The protein insulin consists of two polypeptides termed the A and B chains. Insulins from different organisms have been isolated and sequenced. Human and duck insulins have the same amino acid sequence with the exception of six amino acid residues, as shown below. Which of the followings is true? Amino acid residues A8 A9 A10 B1 B2 B27 Human Thr Glu Gln Thr Asn Gln Duck Asn Asn Pro Arg Glu Lys
- A.
None of the answers
- B.
The pI of human insulin is lower than that of duck
- C.
The pI of human insulin is higher than that of duck
- D.
The pI of human insulin is twice that of duck
- E.
The pI of duck insulin is twice that of huma
- 39.Which of the following statements is correct regarding buffer strength at pH = 5.4 (MOPS:pK=7.2; SHS:pK=5.5)?
- A.
MOPS is more effective against acid and SHS is more effective against base
- B.
MOPS is more effective against both acid and bas
- C.
SHS is more effective against both acid and base
- D.
MOPS is more effective against base and SHS is more effective against acid
- E.
None of the rest
- 40.DNA ligase is an enzyme that:
- A.
Is more specific than restriction endonucleases
- B.
Catalyzes the hydrolysis of the phosphodiester bonds between nucleotide residues
- C.
Catalyzes the hydrolytic excision of a nucleotide residue from the end of a polynucleotide strand
- D.
catalyzes bond formation coupled with the hydrolysis of ATP
- E.
None of the rest
- 41.The amino group of glycine can exist either in the protonated form (-NH3+) or as the free base (-NH2). In order to have 90% of the glycine in its free base form, what must be the numerical relation be between the pH of the solution and the pKa of the amino group of glycine?
- A.
pH-pKa = 2
- B.
pH-pKa = 0
- C.
pH-pKa = -2
- D.
pH-pKa = 1
- E.
pH-pKa = -1
- 42.
- A.
6.49
- B.
6.97
- C.
3.99
- D.
4.07
- E.
9.87
- 43.Which of the following amino acid sequences give rise to the fluorophore of green fluorescent protein shown in Figure 2
- A.
TFG
- B.
NYG
- C.
SYG
- D.
QFS
- E.
GWS
- 44.
- A.
3.99
- B.
6.97
- C.
9.87
- D.
4.07
- E.
6.49
- 45.Absorption of food in the stomach and intestine depends on the ability of molecules to penetrate the cell membranes and pass into the bloodstream. Because hydrophobic molecules are more likely to be absorbed than hydrophilic or charged molecules, the absorption of orally administered drugs may depend on their pKa values and the pH in the digestive organs. If aspirin has an ionizable carboxyl group (pKa = 4.5). The fraction of aspirin not available for absorption in the stomach (if pH=3.5) is
- A.
10/11
- B.
1/101
- C.
100/101
- D.
1/11
- E.
1/1
- 46.Calculate the pI of Phenylalanine
- A.
5.94
- B.
6.07
- C.
6.30
- D.
5.71
- E.
5.76
- 47.Indicate the ionic species that predominate at pH 8 I: NH3 II: NH4(+) III: H3PO4 IV: H2PO4(-) V: HPO4(2-) VI: PO4(3-)
- A.
II & V
- B.
II & IV
- C.
II & III
- D.
I & V
- E.
I & VI
- 48.The volume of a solution of 1 M NaOH that must be added to adjust the pH from 1 to 9 in 20 mL of a 100 mM solution of phosphoric acid is:
- A.
1mL
- B.
2mL
- C.
3mL
- D.
4mL
- E.
5mL
- 49.Calculate the pI of the peptide ATRDAK?
- A.
11.51
- B.
10.21
- C.
5.05
- D.
6.89
- E.
3.03
- 50.
- A.
9.33
- B.
3.92
- C.
7.68
- D.
5.72
- E.
6.04
- 51.Which of the following amino acids when present in the middle of a polypeptide is not charged at pH 12.5?
- A.
E
- B.
R
- C.
D
- D.
K
- E.
None of the rest
- 52.The one-letter symbol for Glutamine, Glutamic acid, Asparagine and Arginine are:
- A.
G, U, A, N respectively
- B.
Q, E, N, R respectively
- C.
E, G, N, A respectively
- D.
E, G, A, R respectively
- E.
None of the rest
- 53.Which of the following amino acids has the R group with the most Nitrogen?
- A.
W
- B.
R
- C.
E
- D.
H
- E.
K
- 54.A protein is least soluble when pH of the solution
- A.
is equal to the pKa of the buffer
- B.
is neutral
- C.
is equal to its pI
- D.
Is acidic
- E.
Is equal to its pKa
- 55.The pH of a 1 L solution containing 100 mL of 1M acetic acid and 8.2g of sodium acetate (formula weight 82g/mol; pK=4.76) is:
- A.
2.76
- B.
6.76
- C.
4.76
- D.
5.76
- E.
3.76
- 56.Which of the following primers can amplify the following DNA segment by PCR? GACTGGTCGCGGATAGCGTATAATATTTCGGAATACGGTATACCCGGATACGGAT
- A.
ATAGGCATAGGC and CTGACCAGCGC
- B.
ATAGGCATAGGC and CCGCGACCAGT
- C.
CTGACCAGCGCC and GACTGGTCGCG
- D.
ATAGGCATAGGC and TATCCGTATCCG
- E.
TATCCGTATCCG and GACTGGTCGCGG
- 57.Which amino acid has the most OH's in the R groups:
- A.
S
- B.
N
- C.
H
- D.
C
- E.
None of the rest
- 58.
- A.
4.07
- B.
5.19
- C.
9.47
- D.
7.09
- E.
3.08
- 59.A protein contains two 60-kD polypeptides and two 40-kD polypeptides. Each 40-kD chain is disulfide bonded to a 60-kD chain. The 100-kD units associate covalently with disulfide bond to form a protein with a molecular mass of 200 kD. Given 2-mercaptoethanol can reduce disulfide bond, which of the followings is not correct?
- A.
Molecular mass determined by gel filtration is 200 kD
- B.
Molecular mass determined by SDS-PAGE without 2-mercaptoethanol is 200 kD
- C.
PAGE shows one single band
- D.
Molecular masses determined by SDS-PAGE with 2-mercaptoethanol are 40kD and 60 kD
- E.
All answers are correct
- 60.The pH of a 1 L solution containing 1 mL of 10 mM SHS, 1 mL of 10 mM MOPS and 20 mL of 500mM HCL is (MOPS:pK=7.2; SHS:pK=5.5):
- A.
2.5
- B.
2.0
- C.
1.5
- D.
1.0
- E.
3.0
- 61.Determine the net charge of the predominant form of Asp at pH 7.0
- A.
-1
- B.
1
- C.
-2
- D.
0
- E.
2
- 62.Which of the following amino acids is/are optically active?
- A.
T
- B.
P
- C.
N
- D.
W
- E.
All of the answers
- 63.Which of the following statements is false?
- A.
Liquid water at 0 degree C has greater entropy than ice at 0 degree C
- B.
Ice has less entropy at -50 degree C than at -5 degree C
- C.
Liquid water spontaneously form ice at 0 degree C
- D.
Ice at -5 degree C has less entropy than water at 20 degree C
- E.
At 0 degree C, free energies of ice and liquid are the same
- 64.For the reaction A --> B at 298K, the change in enthalpy is -7 kJ/mol and the change in entropy is -25 J/(K.mol). Which of the following statements is true
- A.
The reaction is spontaneous
- B.
Decrease of the temperature make the reaction spontaneous
- C.
Increase of the temparature make the reaction spontaneous
- D.
The reaction is non-spontaneous at all temperature
- E.
All of the rest are true
- 65.Which of the following statements is true
- A.
A reaction is said to be spontaneous when it can proceed in either the forward or reverse direction
- B.
A spontaneous process always happens very quickly
- C.
A nonspontaneous reaction will proceed spontaneously in the reverse direction
- D.
A spontaneous process cannot occur with a large decrease in entropy
- E.
All of the rest are true
- 66.Indicate the ionic species that predominate at pH 3 I: Succinate(-2) II: CO3(-2) III: Succinic acid IV: H2CO3 V: Succinate(-1) VI: HCO3(-)
- A.
I & IV
- B.
II & III
- C.
III & IV
- D.
II & V
- E.
III & VI
- 67.The volume of a solution of 0.5 M NaOH that must be added to adjust the pH from 4 to 9 in 20 mL of a 100 mM solution of phosphoric acid is:
- A.
1mL
- B.
2mL
- C.
3mL
- D.
4mL
- E.
5mL
- 68.The pH of a 100 mL solution containing 1 mL of 10 mM SHS, 1 mL of 10 mM MOPS and 20 mL of 500mM HCL is (MOPS:pK=7.2; SHS:pK=5.5):
- A.
1.0
- B.
1.5
- C.
2.0
- D.
2.5
- E.
3.0
- 69.Absorption of food in the stomach and intestine depends on the ability of molecules to penetrate the cell membranes and pass into the bloodstream. Because hydrophobic molecules are more likely to be absorbed than hydrophilic or charged molecules, the absorption of orally administered drugs may depend on their pKa values and the pH in the digestive organs. If aspirin has an ionizable carboxyl group (pKa = 3). The fraction of aspirin available for absorption in the stomach (if pH=1) is:
- A.
1/11
- B.
10/11
- C.
1/101
- D.
100/101
- E.
1/1
- 70.The amino group of glycine can exist either in the protonated form (-NH3+) or as the free base (-NH2). In order to have 100/101 of the glycine in its deprotonated form, what must be the numerical relation be between the pH of the solution and the pKa of the amino group of glycine?
- A.
PH-pKa = -2
- B.
PH-pKa = -1
- C.
PH-pKa = 0
- D.
PH-pKa = 1
- E.
PH-pKa = 2
- 71.Which of the following amino acids has the R group with the most Nitrogen?
- A.
Trytophan
- B.
Glutamine
- C.
Arginine
- D.
Lysine
- E.
Histidine
- 72.Which of the following amino acids is not optically active?
- A.
G
- B.
T
- C.
W
- D.
N
- E.
None of the answers
- 73.Which of the following amino acids when present in the middle of a polypeptide is not charged at pH 8?
- A.
E
- B.
R
- C.
D
- D.
H
- E.
None of the rest
- 74.Determine the net charge of the predominant form of lys at pH 7.0
- A.
-2
- B.
-1
- C.
0
- D.
1
- E.
2
- 75.Calculate the pI of Phenylalanine.
- A.
6.30
- B.
5.76
- C.
5.94
- D.
6.07
- E.
5.71
- 76.Calculate the approximate pI of the peptide AARTRADAEAA?
- A.
3
- B.
10
- C.
7
- D.
4
- E.
11
- 77.The protein insulin consists of two polypeptides termed the A and B chains. Insulins from different organisms have been isolated and sequenced. Human and duck insulins have the same amino acid sequence with the exception of six amino acid residues, as shown below. Which of the followings is true? Amino acid residues A8 A9 A10 B1 B2 B27 Human Thr Arg Glu Thr Asp Glu Duck Asn Asn Pro Glu Glu Asp
- A.
The pI of human insulin is lower than that of duck
- B.
The pI of human insulin is higher than that of duck
- C.
The pK of human insulin is twice that of duck
- D.
The pK of duck insulin is twice that of human
- E.
None of the answers
- 78.A protein is least soluble when pH of the solution is equal to its pI because
- A.
Its net charge is zero
- B.
PH of the solution is equal to it's pKa
- C.
PH of the solution is equal to pKa of the buffer
- D.
Its net charge is most negative
- E.
Its net charge is most positive
- 79.The primary sequence of antifreeze protein from winter flounder is DTASEAAAAAALTAANAKAAAELTAANAAAAAAATAR The first five residues obtained by Edman degradation of antifreeze protein are
- A.
Asp, thr, ala, ser & glu, respectively
- B.
Arg, ala, thr, ala & ala, respectively
- C.
Asp, tyr, ala, ser & Ela, respectively
- D.
Tyr, ala, thr, ala & ala, respectively
- E.
Glu, thr, ala, ser & Try, respectively
- 80.Treatment of bovine insulin (Figure 1) with trypsin alone will generate how many peptide fragments?
- A.
1
- B.
3
- C.
2
- D.
4
- E.
5
- 81.Treatment of bovine insulin (Figure 1) with trypsin and 2-mercaptoethanol will generate how many peptide fragments?
- A.
6
- B.
2
- C.
3
- D.
4
- E.
5
- 82.A protein contains two 60-kD polypeptides and two 30-kD polypeptides. Each 30-kD chain associates with a 60-kD chain noncovalently. The 90-kD units associate covalently via disulfide bond between the two 30-kD chains to form a protein with a molecular mass of 180 kD. Which of the followings is not correct?
- A.
Molecular mass determined by gel filtration is 180 kD
- B.
Molecular mass determined by SDS-PAGE is 90 kD
- C.
Molecular masses determined by SDS-PAGE with 2-mercaptoethanol are 30kD and 60 kD
- D.
PAGE shows one single band
- E.
All answers are correct
- 83.Considering most protein molecules have pIs around 7 and that the buffer used in a particular polyacrylamide gel electrophoresis (PAGE) maintains the pH at around 8.5, which of the followings is correct
- A.
Protein sample will migrate towards the cathode (- electrode)
- B.
Protein sample will migrate towards the anode (+ electrode)
- C.
Proteins that have a pIs below 7 will not enter the gel
- D.
Larger proteins will run faster due to higher charge density
- E.
Proteins with higher net positive charges will run faster
- 84.Two-dimensional gel electrophoresis is a powerful seperation technique that is a combination of which other separation techniques?
- A.
Affinity Chromatography and Capillary electrophoresis
- B.
Isoelectric focusing (IEF) and SDS-PAGE
- C.
High power liquid chromatography (HPLC) and SDS-PAGE
- D.
Affinity Chromatography and SDS-PAGE
- E.
Ultracentrifugation and Capillary electrophoresis
- 85.Which of the following amino acids when present in the middle of a polypeptide is not charged at pH 12?
- A.
E
- B.
R
- C.
D
- D.
Y
- E.
None of the rest
- 86.Determine the net charge of the predominant form of lys at pH 5.0
- A.
-2
- B.
-1
- C.
0
- D.
1
- E.
2
- 87.According to Figure 14, which of the following is not likely to be a serine protease?
- A.
Factor XIa
- B.
Factor VIIa
- C.
Thrombin
- D.
Fibrinogen
- E.
All listed are serine proteases
- 88.Calculate the approximate pI of the peptide AARTKADAEAA
- A.
3
- B.
10
- C.
7
- D.
4
- E.
11
- 89.A protein contains two 60-kD polypeptides and two 30-kD polypeptides. Each 30-kD chain associates with a 60-kD chain covalently via disulfide bond. The 90-kD units associate noncovalently to form a protein with a molecular mass of 180 kD. Which of the followings is not correct?
- A.
Molecular mass determined by gel filtration is 180 kD
- B.
Molecular mass determined by SDS-PAGE is 90 kD
- C.
Molecular masses determined by SDS-PAGE with 2-mercaptoethanol are 30kD and 60 kD
- D.
PAGE shows one single band
- E.
All answers are correct
- 90.Which of the following statements is incorrect about folded protein structure?
- A.
All of the rest
- B.
Native protein structures are only slightly more stable than their denatured forms
- C.
Primary determinants of protein stability are hydrophobic effect
- D.
Hydrogen bonding and ion pairing contributes relatively little to a protein's stability
- E.
Secondary structure of a protein determines its 3D structure
- 91.Which of the following statements is incorrect?
- A.
Irregular secondary structures include omega loops, beta-bulges, beta bends and non-repeating sidechain conformations
- B.
The secondary structure of a protein is the local spatial arrangement of a polypeptide's backbone atoms without regard to the conformations of side chains
- C.
Alpha helix is stabilized by hydrogen bonding between backbone groups four residues apart
- D.
None of the rest
- E.
Beta sheet is stabilized by hydrogen bonding between the backbones of separate polypeptide strands
- 92.Chaperonins such as the GroEL/ES system function ____.
- A.
With thermophilic proteins only
- B.
At low pH
- C.
In an ATP-dependent fashion
- D.
In vitro only
- E.
In a non-aqueous environment
- 93.When collagen is heated to produce gelatin, which of the following interactions is not being broken?
- A.
Hydrophobic effects
- B.
Van der Waals interactions
- C.
Hydrogen bonds
- D.
Covalent interactions
- E.
All given interactions are being broken
- 94.Which of the following polypeptides is most likely to assume alpha helical conformation at pH 2?
- A.
Polylysine
- B.
Polyglutamic acid
- C.
Polyglycine
- D.
Polyserine
- E.
Polyvaline
- 95.Which of the following polypeptides is most likely to assume beta conformation at pH 7?
- A.
Poly-E
- B.
Poly-Y
- C.
Poly-A
- D.
Poly-D
- E.
Poly-L
- 96.Which of the following statements is false
- A.
Liquid water at 0 degree C has greater entropy than ice at 0 degree C
- B.
Liquid water at 0 degree C has less enthalpy than ice at 0 degree C
- C.
Ice has less entropy at -50 degree C than at -5 degree C
- D.
At -1 degree C, liquid water spontaneously form ice
- E.
All statements are correct
- 97.Prosthetic groups are
- A.
Cofactors that permanently associate with their proteins, often convalently
- B.
Synthetic molecules that act as substrates
- C.
Cofactors that permanently bind to carbohydrates
- D.
Cofactors that permanently bind to enzymes, often by ionic bonds
- E.
None of the rest
- 98.Enzymes differ from ordinary chemical catalysts in that their reactions:
- A.
Have slower reaction rates
- B.
Have a much reduced free energy of reaction
- C.
Often have side products
- D.
Have less specificity
- E.
None of the rest
- 99.Which of the following compounds has highest affinity to its cognate enzyme
- A.
Substrate
- B.
Allosteric inhibitor
- C.
Transition state
- D.
Product
- E.
None of the answers
- 100.Which of the following is incorrect about vitamins?
- A.
They can act as a coenzyme precursor
- B.
They must be water-soluble to be a coenzyme precursor
- C.
Lipid-soluble vitamins are generally not components of coenzymes
- D.
They are essential to humans (i.e. their absence can ultimately result in death)
- E.
None of the rest
- 101.Activation of a zymogen is commonly accomplished in vivo by
- A.
Aggregation of inactive subunits
- B.
Dissociation of inactive subunits
- C.
Formation of disulfide bonds
- D.
Limited proteolysis
- E.
Addition of a co-enzyme
- 102.Proteolytic enzymes' inactive precursors are known specifically as
- A.
Apoenzymes
- B.
Zymogens
- C.
Haloenzymes
- D.
Proenzymes
- E.
None of the rest
- 103.A catalytic triad is likely found in which of the following enzymes?
- A.
Factor VIII
- B.
Thrombin
- C.
Acetylcholinesterase
- D.
Catalase
- E.
Urease
- 104.Tosyl-L-Lys-L-Tyr-L-Val chloromethylketone is a good irreversible inhibitor of _____.
- A.
Urease
- B.
Trypsin
- C.
Elastase
- D.
Thermolysin
- E.
All of the answers
- 105.Which of the following enzymes is the most efficient enzyme?
- A.
Chymotrypsin with N-Acetylglycine ethyl ester
- B.
Chymotrypsin with N-Acetylvaline ethyl ester
- C.
Trypsin with N-Acetyglycine ethyl ester
- D.
Elastase with N-Acetytyrosine ethyl ester
- E.
Elastase with N-Acetylvaline ethyl ester
- 106.Which of the following residues never act as a base catalyst?
- A.
His 12 in RNase A
- B.
His 119 in RNase A
- C.
His 57 in serine protease
- D.
Asp 102 in serine protease
- E.
All listed act as base catalyst at some point in the respective enzyme catalyzed reaction
- 107.According to step 1 in Figure 1, the pKa of His 57 is
- A.
Increased by the action of Asp 102
- B.
Decreassed by the action of Asp 102
- C.
Increased by the action of Ser 195
- D.
Decreased by the action of Ser 195
- E.
Not affected by its environment
- 108.Which of the following is false concerning the base composition of DNA?
- A.
In a double stranded DNA, the number of A = T
- B.
In a double stranded DNA, the number of C = G
- C.
In a double stranded DNA, A / C = T / G
- D.
In a double stranded DNA, the number of A + G = T + G
- E.
All of the rest are true
- 109.What is false about the denaturation of DNA?
- A.
It involves the separation of DNA's double helix
- B.
Viscosity of the DNA solution decreases
- C.
UV absorbance decreases
- D.
It is a cooperative phenomenon
- E.
It is often reversible
- 110.Which of the following operations will decrease the Tm of a duplex DNA
- A.
Decreasing the ionic strength of the solution
- B.
Addition of a small amount of ethanol to the solution
- C.
Increase the A:T content of the DNA
- D.
All listed operations will decrease the Tm of a duplex DNA
- E.
All listed operations will increase the Tm of a duplex DNA
- 111.Which of the following statements is incorrect?
- A.
Naturally occurring DNA is negatively supercoiled
- B.
Topoisomerases relax supercoils by cleaving one or both strands of the DNA, passing the DNA through the break or allowing controlled rotation of the uncleaved strand, and resealing the broken strand(s).
- C.
The structures of nucleic acids are stabilized by hydrophobic interactions between stacked base pairs
- D.
The structures of nucleic acids are stabilized by divalent cations that shield adjacent phosphate groups
- E.
All listed statements are correct
- 112.A plasmid with 3600 bp of closed circular duplex DNA was isolated from E. coli. It has a 300-bp segment of alternating C and G residues. On transfer to a high salt solution, this segment undergoes a transition from the B conformation to the Z conformation. Given that B-DNA contains one right-handed turn per 10 base pairs, Z-DNA contains one left-handed turn per 12 base pairs and linking number (L) equals twist (T) plus writhing number (W). Which of the followings is incorrect?
- A.
Its original linking number is 360
- B.
The change in its writhing number is 55
- C.
The change in its twist is -55
- D.
Its linking number is not changed
- E.
All answers are correct
- 113.If 50% of the DNA in a relaxed circular-covalently-closed plasmid is induced to change from B-DNA to Z-DNA and then treated by an enzyme that has type IB topoisomerase activity, what happens to the value of the linking number?
- A.
Increases
- B.
Decreases
- C.
Remains the same
- D.
Multiplies by a factor of 2
- E.
None of the answers
- 114.Which of the following statements is incorrect?
- A.
Sequence-specific DNA-binding proteins interact primarily with bases in the minor groove and with phosphate groups
- B.
Sequence-specific DNA-binding proteins interaction with DNA involves direct and indirect hydrogen bonds
- C.
Sequence-specific DNA-binding proteins interaction with DNA involves van der Waals interactions
- D.
Sequence-specific DNA-binding proteins interaction with DNA involves ionic interactions
- E.
Sequence-specific DNA-binding proteins interaction with DNA may involves conformational changes in protein and DNA
- 115.Common structural motifs in DNA-binding proteins include the followings except
- A.
The helix-turn-helix motif
- B.
Zinc fingers
- C.
Leucine dimer
- D.
Basic helix-loop-helix motifs
- E.
All of the listed are common structural motifs in DNA-binding proteins
- 116.E. coli DNA polymerase III lacks which of the following activities
- A.
Polymerase activity at the 3' end
- B.
3'-5' exonuclease activity
- C.
5'-3' exonuclease activity
- D.
All of the rest
- E.
None of the rest
- 117.Which component would act as a sliding clamp in E. Coli?
- A.
Alpha subunit of DNA polymerase I
- B.
Sigma subunit of RNA polymerase
- C.
Beta subunit of DNA polymerase III
- D.
Helicase
- E.
DNA ligase
- 118.Which of the following increases processivity of its related reaction?
- A.
Primosome
- B.
RNA of telomerase
- C.
Hammerhead ribozyme
- D.
Sigma factor of E.coli RNA polymerase
- E.
Beta subunit of E.coli DNA polymerase III
- 119.The high fidelity of DNA replication is achieved by the followings except
- A.
The regulation of dNTP levels
- B.
The requirement for RNA primers
- C.
3' -> 5' proofreading
- D.
DNA repair mechanisms
- E.
All listed are important for achieving the high fidelity of DNA replication
- 120.Loss of which of the following genes (proteins) in E. coli would not be lethal
- A.
DnaB (helicase DnaB)
- B.
PolA (Pol I)
- C.
Ssb (SSB)
- D.
DNA ligase
- E.
All of the listed genes are essential, loss of anyone is lethal
- 121.After Okazaki fragements are formed by DNA polymerase III and primase, which of the following enzyme(s) is(are) required to join them together?
- A.
DNA polymerase I
- B.
DNA ligase
- C.
DNA polymerase II
- D.
DNA gyrase
- E.
DNA polymerase I and DNA ligase
- 122.Which of the followings is incorrect about telomerase
- A.
It is for the addition of telomeric sequences
- B.
It is not found in somatic cells
- C.
Its existence is related to the requirement for replication of the 5'end of the lagging strand
- D.
All listed are correct
- E.
All listed are incorrect
- 123.Which of the following is not correct about the SOS response:
- A.
Induced by DNA damage
- B.
Decreased cell division
- C.
Increased DNA repair capacity
- D.
Decreased error checking capacity
- E.
All answers are correct
- 124.According to Figure 6, which of the following is likely to be a serine protease?
- A.
Factor VIIIa
- B.
Factor Va
- C.
Thrombin
- D.
Tissue Factor
- E.
All listed are serine proteases
- 125.A protein contains two 60-kD polypeptides and two 30-kD polypeptides. Each 60-kD chain associates with a 60-kD chain covalently via disulfide bond. The 30-kD units also associate covalently via disulfide bond. Which of the followings is not correct?
- A.
Molecular mass determined by gel filtration is 180 kD
- B.
Molecular mass determined by SDS-PAGE is 90 kD
- C.
Molecular masses determined by SDS-PAGE with 2-mercaptoethanol are 30kD and 60 kD
- D.
PAGE shows one single band
- E.
All answers are correct
- 126.A catalytic triad is not likely to be found in which of the following enzymes?
- A.
Factor VII
- B.
Thrombin
- C.
Acetylcholinesterase
- D.
Serine carboxypeptidase II
- E.
Subtilisin
- 127.Tosyl-L-Lys-L-Tyr-L-Lys chloromethylketone is a good irreversible inhibitor of _____.
- A.
Urease
- B.
Trypsin
- C.
Elastase
- D.
Thermolysin
- E.
All of the answers
- 128.Which of the following enzymes is the most efficient enzyme?
- A.
Chymotrypsin with N-Acetylglycine ethyl ester
- B.
Chymotrypsin with N-Acetyltyrosine ethyl ester
- C.
Trypsin with N-Acetyglycine ethyl ester
- D.
Elastase with N-Acetytyrosine ethyl ester
- E.
Elastase with N-Acetylysine ethyl ester
- 129.Which of the following residues act as a acid catalyst?
- A.
His 12 in RNase A - Figure 5, step 1
- B.
His 119 in RNase A - Figure 5, step 2
- C.
His 12 in RNase A - Figure 5, step 2
- D.
Asp 102 in serine protease - Figure 1, step 1
- E.
All listed are base catalysts
- 130.According to step 1 in Figure 1, the pKa of His 57 is
- A.
Increased by the action of Asp 102
- B.
Decreassed by the action of Asp 102
- C.
Increased by the action of Ser 195
- D.
Decreased by the action of Ser 195
- E.
Not affected by its environment
- 131.Which of the following statements is incorrect?
- A.
Naturally occurring DNA is negatively supercoiled.
- B.
Topoisomerases relax supercoils by cleaving one or both strands of the DNA, passing the DNA through the break or allowing controlled rotation of the uncleaved strand, and resealing the broken strand(s).
- C.
Stacking interaction between bases is enthalpically driven
- D.
The structures of nucleic acids are stabilized by divalent cations that shield adjacent phosphate groups
- E.
All listed statements are correct
- 132.
- A.
Increase the ionic strength of the solution
- B.
Addition of a small amount of ethanol to the solution
- C.
Increase the A:T content of the DNA
- D.
All listed operations will decrease the Tm of a duplex DNA
- E.
All listed operations will increase the Tm of a duplex DNA
- 133.A plasmid with 3600 bp of closed circular duplex DNA was isolated from E. coli. The plasmid was transferred to a high salt solution and then treated with an enzyme with type Ib topoisomerase activity. After topoisomerase treatment the plasmid is transferred back to a low salt solution. This plasmid has a 300-bp segment of alternating C and G. This segment undergoes equilibrium transition from the B conformation to the Z conformation upon transfer to the high salt solution. Given that B-DNA contains one right-handed turn per 10 base pairs, Z-DNA contains one left-handed turn per 12 base pairs and linking number (L) equals twist (T) plus writhing number (W). Which of the followings is incorrect?
- A.
Its original twist is equal to 360
- B.
Its final writhing number is -55
- C.
Its final linking number is 305
- D.
Its final twisting number is 305
- E.
All answers are correct
- 134.Given that B-DNA contains one right-handed turn per 10 base pairs, Z-DNA contains one left-handed turn per 12 base pairs and linking number (L) equals twist (T) plus writhing number (W). If 20% of the DNA in a relaxed circular-covalently-closed plasmid is induced to change from B-DNA to Z-DNA and then treated by an enzyme with type IA topoisomerase activity. What happens to the value of the twisting number?
- A.
Increases
- B.
Decreases
- C.
Remains the same
- D.
Mutiplies by a factor of 3
- E.
None of the answers
- 135.Which of the following statements about DNA Pol I is false?
- A.
DNA Pol I has exonuclease activity
- B.
DNA Pol I is the primary replicase in E. coli
- C.
DNA Pol I functions in DNA repair
- D.
Mutation analysis demonstrates the DNA Pol I activity is necessary for cell survival
- E.
DNA Pol I can be used to radioactively label DNA in lab experiments
- 136.Which of the following is false about prokaryotic transcription?
- A.
Conserved sequences are found upstream from the starting point
- B.
10 bases before the start of transcription is known as the pribnow box
- C.
The release factor is released as transcription proceeds
- D.
The conserved sequences found upstream from the starting point are known as the -10 and -35 region.
- E.
All answers are true
- 137.Select the false statement
- A.
Some eukaryotic rRNAs are self-splicing
- B.
RNA can act as an enzyme
- C.
Self-splicing rRNAs require energy input
- D.
RRNA self-splicing consists of a series of transesterification reactions
- E.
In order to be an efficient catalyst, a macromolecule must be able to form a stable structure
- 138.How does the preinitiation complex begin to form at a TATA box-containing promoter?
- A.
RNAP binds to the sigma factor
- B.
RNAP binds to the initiator (Inr) element
- C.
TATA-binding protein binds to the TATA box
- D.
RNAP binds to the Rho factor
- E.
None of the above.
- 139.In eukaryotes, mRNAs are synthesized in the cell ______, whereas most translation occurs in the ______.
- A.
Nucleus, nucleosome
- B.
Nucleus, cytosol
- C.
Cytosol, nucleosome
- D.
Cytosol, nucleus
- E.
Nucleosome, cytosol
- 140.The triplet code allows many amino acids to be specified by more than one codon. Such a code is said to be ______.
- A.
Replicative
- B.
Recursive
- C.
Conclusive
- D.
Elusive
- E.
Degenerate
- 141.Polypeptide synthesis proceeds from the ______ to the ______.
- A.
C-terminus, N-terminus
- B.
Exit site, modification site
- C.
N-terminus, C-terminus
- D.
Modification site, exit site
- E.
40S subunit, 60S subunit
- 142.Which of the following enzymes has proofreading activity?
- A.
All DNA polymerase
- B.
All RNA polymerase
- C.
All aminoacyl-tRNA synthetase
- D.
All DNA ligase
- E.
None of the rest
- 143.Activation of coagulation factor VII is accomplished in vivo by
- A.
Aggregation of inactive subunits
- B.
Dissociation of inactive subunits
- C.
Formation of disulfide bonds
- D.
Limited proteolysis alone
- E.
Limited proteolysis and addition of a protein cofactor
- 144.Which of the following is correct about enzyme catalysed reactions with an uncompetitive inhibitor
- A.
Vmax is smaller and Km is unchanged with I when compared to no I
- B.
Km is smaller and Vmax is unchanged with I when compared to no I
- C.
Vmax is larger and Km is unchanged with I when compared to no I
- D.
Km is larger and Vmax is unchanged with I when compared to no I
- E.
Both Vmax and Km are smaller with I when compared to no I
- 145.Which of the following is correct about enzyme catalysed reactions with a competitive inhibitor (I)
- A.
Vmax is smaller and Km is unchanged with I when compared to no I
- B.
Km is smaller and Vmax is unchanged with I when compared to no I
- C.
Vmax is larger and Km is unchanged with I when compared to no I
- D.
Km is larger and Vmax is unchanged with I when compared to no I
- E.
Both Vmax and Km are smaller with I when compared to no I
- 146.Which of the following is correct about enzyme catalysed reactions with an irreversible inhibitor (I)
- A.
Vmax is smaller and Km is unchanged with I when compared to no I
- B.
Km is smaller and Vmax is unchanged with I when compared to no I
- C.
Vmax is larger and Km is unchanged with I when compared to no I
- D.
Both Vmax and Km are smaller with I when compared to no I
- E.
None of the rest
- 147.The volume of a solution of 1.0 M NaOH that must be added to adjust the pH from 1 to 11 in 20 mL of a 100 mM solution of Succinic acid is:
- A.
3mL
- B.
2mL
- C.
4mL
- D.
1mL
- E.
5mL
- 148.The amino group of glycine can exist either in the protonated form (-NH3+) or as the free base (-NH2). In order to have 90% of the glycine in its acidic form, what must be the numerical relation be
- A.
pH-pKa = 2
- B.
pH-pKa = -2
- C.
pH-pKa = -1
- D.
pH-pKa = 0
- E.
pH-pKa = 1
- 149.A mixture of protein molecules having pI’s ranging from 4 to 12 is analyzed on an IsoElectric Focusing device where protein molecules are separated according to their attraction towards the electrodes. Which of the followings is correct?
- A.
Protein molecules with higher molecular weight migrate closer to the cathode (- electrode)
- B.
Protein molecules with higher pI migrate closer to the cathode (- electrode)
- C.
Protein molecules with lower pI migrate closer to the cathode (- electrode)
- D.
Protein molecules with lower molecular weight migrate closer to the cathode (- electrode)
- E.
All given answers are incorrect
- 150.Which of the following amino acids when present in the middle of a polypeptide is not charged at pH 11?
- A.
Y
- B.
E
- C.
D
- D.
R
- E.
None of the rest
- 151.
- A.
6.49
- B.
5.06
- C.
3.99
- D.
6.97
- E.
9.87
- 152.Which of the following statement is incorrect?
- A.
Leu is more likely than Ile to be found in the middle of an alpha helix
- B.
Ser is more likely than Gln to be found on a protein's surface
- C.
Ser is less likely than Val to be in the protein's interior
- D.
Cys is more likely than Ser to be in a beta sheet
- E.
All statements are correct
- 153.A protein contains two 60-kD polypeptides and two 30-kD polypeptides. Each 30-kD chain associates with a 60-kD chain noncovalently. The 90-kD units associate covalently via disulfide bond between the two 30-kD chains to form a protein with a molecular mass of 180 kD. Which of the followings is not correct?
- A.
Molecular mass determined by gel filtration is 180 kD
- B.
Molecular mass determined by SDS-PAGE is 90 kD
- C.
PAGE shows one single band
- D.
Molecular masses determined by SDS-PAGE with 2-mercaptoethanol are 30kD and 60 kD
- E.
All answers are correct
- 154.Which of the followings best describes a protein molecule at pH above its isoelectric point?
- A.
Least stable
- B.
Positively charged
- C.
least soluble
- D.
Most soluble
- E.
Negatively charged
- 155.
- A.
A beta bulge, which forms when an “extra” residue occurs in a beta sheet and is not hydrogen-bonded to a neighboring strand
- B.
Denatured proteins, which are fully unfolded and have rapidly fluctuating conformations
- C.
Random coils, which are totally disordered.
- D.
All statements describe nonrepetitive protein structures.
- E.
None of the rest.
- 156.Which of the following statement is incorrect about folded protein structure?
- A.
Primary determinants of protein stability are hydrophobic effect
- B.
Hydrogen bonding and ion pairing contributes relatively little to a protein's stability
- C.
Native protein structures are only slightly more stable than their denatured forms
- D.
Secondary structure of a protein determines its 3D structure
- E.
All of the rest
- 157.Which of the following polypeptides is most likely to assume alpha helical conformation at pH 7?
- A.
Polyglutamic acid
- B.
Polyserine
- C.
Polyalanine
- D.
Polylysine
- E.
Polyvaline
- 158.Which of the following polypeptides is most likely to assume a random coil conformation at pH 2?
- A.
Polyaspartic acid
- B.
Polyalanine
- C.
Polyglycine
- D.
Polyglutamic acid
- E.
Polyvaline
- 159.
- A.
3.99
- B.
6.97
- C.
5.06
- D.
9.87
- E.
6.49
- 160.Which of the following polypeptides is most likely to assume beta conformation at pH 2?
- A.
Poly-D
- B.
Poly-A
- C.
Poly-E
- D.
Poly-L
- E.
Poly-Y
- 161.Activation of coagulation factor IX can be accomplished in vivo by
- A.
Factor VIIa and Factor X
- B.
Aggregation of inactive subunits
- C.
Dissociation of inactive subunits
- D.
Factor VIIa alone
- E.
Factor XIa alone
- 162.Tosyl-L-Tyrosine Ethylester is a _____ of chymotrypsin.
- A.
all of the answers
- B.
irreversible inhibitor
- C.
reversible inhibitor
- D.
Substrate
- E.
None of the answers
- 163.
- A.
Increases
- B.
Decreases
- C.
Remains the same
- D.
Multiplies by a factor of 2
- E.
None of the answers
- 164.Which of the following compounds has highest affinity to its cognate enzyme
- A.
allosteric inhibitor
- B.
Product
- C.
Transition state
- D.
Substrate
- E.
None of the answers
- 165.Which of the following statements is incorrect?
- A.
Topoisomerases relax supercoils by cleaving one or both strands of the DNA, passing the DNA through the break or allowing controlled rotation of the uncleaved strand, and resealing the broken strand(s).
- B.
Naturally occurring DNA is negatively supercoiled.
- C.
The structures of nucleic acids are stabilized by hydrophobic interactions between stacked base pairs
- D.
The structures of nucleic acids are stabilized by divalent anions that shield adjacent phosphate group
- E.
All listed statements are correct
- 166.Tosyl-L-Lys-L-Tyr-L-Val chloromethylketone is a good irreversible inhibitor of _____.
- A.
Thermolysin
- B.
Trypsin
- C.
Urease
- D.
Elastase
- E.
All of the answers
- 167.If 50% of the DNA in a relaxed circular-covalently-closed plasmid is induced to change from B-DNA to Z-DNA and then treated by an enzyme that has type IB topoisomerase activity, what happens to the value of the linking number?
- A.
Decreases
- B.
Increases
- C.
Remains the same
- D.
Multiplies by a factor of 2
- E.
None of the answers
- 168.Which of the following enzymes is the most efficient enzyme?
- A.
Chymotrypsin with N-Acetylvaline ethyl ester
- B.
Elastase with N-Acetytyrosine ethyl ester
- C.
Chymotrypsin with N-Acetylglycine ethyl ester
- D.
Trypsin with N-Acetyglycine ethyl ester
- E.
Elastase with N-Acetylvaline ethyl ester
- 169.Activation of zymogen is commonly accomplished in vivo by
- A.
Complete proteolysis by another protease
- B.
Aggregation of inactive subunits
- C.
Formation of disulfide bonds
- D.
Limited proteolysis by another zymogen
- E.
none of the rest
- 170.Tosyl-L-Phenylalanine-ethyl ester is a ________ of thermolysin
- A.
Substrate
- B.
Irreversible inhibitor
- C.
Competitive inhibitor
- D.
All of the answers
- E.
None of the answers
- 171.Activation of coagulation factor X can be accomplished in vivo by
- A.
Aggregation of inactive subunits
- B.
Dissociation of inactive subunits
- C.
Factor IXa alone
- D.
Factor VIIa alone
- E.
Factor IXa and Factor VIII
- 172.Which of the following amino acids when present in the middle of a polypeptide is not charged at pH 14?
- A.
E
- B.
Y
- C.
D
- D.
K
- E.
None of the rest
- 173.Which of the following enzymes is the least efficient enzyme?
- A.
Trypsin with N-Acetylarginine ethyl ester
- B.
Catalase with H2O2 as substrate
- C.
Fumarase with malate as substrate
- D.
Carbonic anhydrase with CO2 as substrate
- E.
Acetycholinesterase with acetylcholine as substrate
- 174.
- A.
it involves the separation of DNA's double helix
- B.
UV absorbance increases
- C.
It is a cooperative phenomenon
- D.
Viscosity of the DNA solution increases
- E.
it is often reversible
- 175.Which of the following polypeptides is least likely to assume beta sheet conformation at pH 14?
- A.
Poly-A
- B.
Poly-R
- C.
Poly-M
- D.
Poly-Y
- E.
Poly-L
- 176.A plasmid with 2400 bp of closed circular duplex DNA was isolated from E. coli. It has a 300-bp segment of alternating C and G residues. On transfer to a high salt solution, this segment undergoes a transition from the B conformation to the Z conformation. Given that B-DNA contains one right-handed turn per 10 base pairs, Z-DNA contains one left-handed turn per 12 base pairs and linking number (L) equals twist (T) plus writhing number (W). Which of the followings is incorrect?
- A.
All answers are correct
- B.
The change in its writhing number is 55
- C.
Its original twist is 240
- D.
There is no change in its linking number
- E.
The change in its twist is -55
- 177.Tosyl-L-Valine chloromethylketone is an irreversible inhibitor of _____.
- A.
chymotrypsin
- B.
Thermolysin
- C.
Pepsin
- D.
Trypsin
- E.
None of the answers
- 178.Which of the following polypeptides is most likely to assume beta conformation at pH 7?
- A.
Poly-E
- B.
Poly-Y
- C.
Poly-A
- D.
Poly-L
- E.
Poly-D
- 179.Which of the following is not correct about the SOS response:
- A.
All answers are correct
- B.
Induced by DNA damage
- C.
Decreased cell division
- D.
Increased error checking capacity
- E.
Increased DNA repair capacity
- 180.E. coli DNA polymerase I has which of the following activities
- A.
5’-3’ exonuclease activity
- B.
polymerase activity at the 3’ end
- C.
3’-5’ exonuclease activity
- D.
None of the rest
- E.
All of the rest
- 181.Which component would act as a sliding clamp in E. Coli?
- A.
helicase
- B.
Sigma subunit of RNA polymerase
- C.
Alpha subunit of DNA polymerase I
- D.
Beta subunit of DNA polymerase III
- E.
DNA ligase
- 182.Reverse transcriptase requires the followings for its activity except
- A.
primer
- B.
Deoxynucleoside triphosphates
- C.
RNA template
- D.
Promoter
- E.
all of the listed are required.
- 183.
- A.
Decreases
- B.
Mutiplies by a factor of 2
- C.
remains the same
- D.
Increases
- E.
None of the answers
- 184.Which of the following is false about prokaryotic transcription?
- A.
all answers are true
- B.
The conserved sequences found upstream from the starting point are known as the -10 and -35 region.
- C.
Conserved sequences are found upstream from the starting point
- D.
The rho factor is released as transcription proceeds
- E.
10 bases before the start of transcription is known as the pribnow box
- 185.E. coli's RNA polymerase holoenzyme contains 6 polypeptides: two identical 95-kD alpha subunit, one 65-kD beta subunit, one 60-kd beta' subunit, one 20-kD omega subunit and one 70-kD Sigma subunit. The two alpha subunits are linked to each other by disuphide bond. The beta and beta' subunits are also linked to each other by disulphide bond. The enzyme was extracted from a complex mid-way through transcription with complete removal of DNA and RNA. Which of the followings is correct?
- A.
Molecular mass determined by SDS-PAGE without 2-mercaptoethanol are 190, 125, 70 and 20 kD
- B.
Molecular mass determined by gel filtration is 405 kD
- C.
Molecular masses determined by SDS-PAGE with 2-mercaptoethanol are 95, 70, 65, 60 and 20 kD
- D.
PAGE shows one single band
- E.
All answers are correct
- 186.Telomeric DNA is rich in which of the following nitrogenous bases?
- A.
T
- B.
A
- C.
U
- D.
C
- E.
G
- 187.Tosyl-L-Lys-L-Tyr-L-Pro chloromethylketone is a good irreversible inhibitor of _____.
- A.
Trypsin
- B.
Thermolysin
- C.
Urease
- D.
Elastase
- E.
None of the answers
- 188.Which of the following enzymes has activity most related/similar to reverse transcriptase?
- A.
Telomerase
- B.
DNA polymerase
- C.
DNA ligase
- D.
RNA polymerase
- E.
Primase
- 189.Which of the followings is incorrect about telomerase
- A.
It is not found in somatic cells
- B.
It is for the addition of telomeric sequences
- C.
its existence is related to the requirement for replication of the 3'end of the lagging strand
- D.
All listed are correct
- E.
All listed are incorrect
- 190.A relaxed plasmid with 2400 bp of closed circular duplex DNA has a 300-bp segment of alternating C and G residues. Upon transfer to a high salt solution, this segment undergoes a transition from the B conformation to the Z conformation. Given that B-DNA contains one righthanded turn per 10 base pairs, Z-DNA contains one left-handed turn per 12 base pairs and linking number (L) equals twist (T) plus writhing number (W). Which of the followings is incorrect?
- A.
Its original linking number is 240
- B.
There is no change in its linking number
- C.
The change in its twist is -55
- D.
The change in its writhing number is 55
- E.
All answers are correct
- 191.Tosyl-L-Phenylalanine-ethyl ester is a ________ of trypsin?
- A.
All of the answers
- B.
Irreversible inhibitor
- C.
Substrate
- D.
Competitive inhibitor
- E.
None of the answers
- 192.The high fidelity of DNA replication is achieved by the followings except
- A.
All listed are important for achieving the high fidelity of DNA replication
- B.
3' -> 5' proofreading
- C.
DNA repair mechanisms
- D.
the requirement for RNA primers
- E.
The regulation of dNTP levels
- 193.All of the following are involved in initiation of replication except:
- A.
SSB
- B.
Sigma factor
- C.
DnaB
- D.
DnaA
- E.
ATP
- 194.Which of the following enzymes has activity most related/similar to primase?
- A.
DNA ligase
- B.
DNA polymerase
- C.
RNA polymerase
- D.
Telomerase
- E.
Reverse transcriptase
- 195.Which of the following polypeptides is least likely to assume beta sheet conformation at pH 1?
- A.
poly-D
- B.
poly-E
- C.
poly-M
- D.
poly-Y
- E.
poly-H
- 196.Which of the following increases processivity of its related reaction?
- A.
Primosome
- B.
Sigma factor of E.coli RNA polymerase
- C.
RNA of telomerase
- D.
Hammerhead ribozyme
- E.
beta subunit of E.coli DNA polymerase III
- 197.DNA polymerase requires the followings for its activity except
- A.
DNA template
- B.
Primer
- C.
Promoter
- D.
Deoxynucleoside triphosphates
- E.
All of the listed are required
- 198.If 50% of the DNA in a relaxed circular-covalently-closed plasmid is induced to change from B-DNA to Z-DNA and then treated by an enzyme that has type IA topoisomerase activity, what happens to the value of the writhing number?
- A.
Increases
- B.
Decreases
- C.
Remains the same
- D.
None of the answers
- E.
Multiplies by a factor of 2
- 199.Which of the following amino acids when present in the middle of a polypeptide is charged at pH 1?
- A.
E
- B.
W
- C.
D
- D.
Y
- E.
None of the rest
- 200.Indirect readout refers to:
- A.
A protein’s ability to form hydrogen bonds through a network of water molecules
- B.
The 5′ to 3′ sequence on the opposite strand of a DNA helix
- C.
a protein’s ability to recognize a specific DNA sequence by its backbone conformation and flexibility
- D.
All of the above
- E.
None of the above
- 201.The triplet code allows many amino acids to be specified by more than one codon. Such a code is said to be ______.
- A.
Replicative
- B.
Recursive
- C.
Conclusive
- D.
Elusive
- E.
Degenerate
- 202.
- A.
RNAP binds to the sigma factor
- B.
RNAP binds to the initiator (Inr) element
- C.
TATA-binding protein binds to the TATA box
- D.
RNAP binds to the Rho factor.
- E.
None of the above
- 203.Which of the following statements about Pol I is false?
- A.
Pol I has exonuclease activity
- B.
Pol I is not the primary replicase in E. coli
- C.
Pol I functions in DNA repair
- D.
Mutation analysis demonstrates the Pol I activity is not necessary for cell survival
- E.
Pol I is used to radioactively label DNA in lab experiments
- 204.In order for an enzymatic reaction obeying the Michaelis–Menten equation to reach 3/4 of its maximum velocity
- A.
[S] would need to be 2KM
- B.
Not enough information is given to make this calculation
- C.
[S] would need to be 50% greater than KM
- D.
[S] would need to be 3KM
- E.
[S] would need to be 3/4KM
- 205.The KM can be considered to be the same as the dissociation constant KS for E + S binding if:
- A.
this statement cannot be completed because KM can never approximate KS.
- B.
ES → E + P is fast compared to ES → E + S.
- C.
The turnover number is very large.
- D.
K2
- E.
kcat/KM is near the diffusion-controlled limit.
- 206.The imidazole side chain of histidine can function as either a general acid catalyst or a general base catalyst because:
- A.
in the physiological pH range both H + and OH – are present at high concentrations.
- B.
In the physiological pH range, the nitrogen in the ring can be easily protonated/deprotonated.
- C.
one guanidino group is protonated, and the other is deprotonated at physiological pH
- D.
The imidazole group is a strong reducing agent at physiological pH.
- E.
the sulfur atoms in the ring can either gain or lose a proton at physiological pH
- 207.If you add enzyme to a solution containing only the product(s) of a reaction, would you expect any substrate to form?
- A.
Yes, because the enzyme reduces the standard free energy change for the reaction.
- B.
No, because the enzyme lowers the transition state energy barrier.
- C.
No, because product inhibits the enzyme.
- D.
No, because enzymes catalyze only the forward reaction
- E.
Yes, because the reaction proceeds backwards until reaching equilibrium.
- 208.The “salting in” of proteins can be explained by:
- A.
Salt counter-ions reducing electrostatic attractions between protein molecules.
- B.
Proteins attracting primarily salt cations.
- C.
proteins attracting primarily salt anions.
- D.
Releasing hydrophobic proteins from nonpolar tissue environments.
- E.
Hydration of the salt ions reducing solubility of proteins
- 209.The volume of a solution of 2.0 M NaOH that must be added to adjust the pH from 1 to 11 in 20 mL of a 100 mM solution of Succinic acid is:
- A.
1mL
- B.
2mL
- C.
3mL
- D.
4mL
- E.
5mL
- 210.
- A.
3.99
- B.
6.97
- C.
6.49
- D.
5.06
- E.
7.96
- 211.Which of the following polypeptides is most likely to assume beta conformation at pH 2?
- A.
Poly-E
- B.
Poly-Y
- C.
Poly-A
- D.
Poly-D
- E.
Poly-L
- 212.Which of the following amino acids when present in the middle of a polypeptide is not charged at pH 11?
- A.
E
- B.
R
- C.
D
- D.
Y
- E.
None of the rest
- 213.Which of the following statement is correct about folded protein structure?
- A.
Native protein structures are only slightly more stable than their denatured forms
- B.
Primary determinants of protein stability are hydrophobic effect
- C.
Hydrogen bonding and ion pairing contributes relatively little to a protein's stability
- D.
Primary structure of a protein determines its 3D structure
- E.
All of the rest
- 214.Which of the following enzymes has proofreading activity?
- A.
DNA polymerase III
- B.
RNA polymerase
- C.
Aminoacyl-tRNA synthetase
- D.
A & c
- E.
B & c
- 215.Which of the following statements is incorrect?
- A.
Naturally occurring DNA is negatively supercoiled.
- B.
Topoisomerases relax supercoils by cleaving one or both strands of the DNA, passing the DNA through the break or allowing controlled rotation of the uncleaved strand, and resealing the broken strand(s).
- C.
Stacking interaction between bases is entropically driven
- D.
The structures of nucleic acids are stabilized by divalent cations that shield adjacent phosphate groups
- E.
All listed statements are correct
- 216.The flexibility of nucleotides in nucleic acids is constrained by the followings except
- A.
the allowed rotation angles around the glycosidic bond
- B.
The puckering of the ribose ring
- C.
the torsion angles of the sugar-phosphate backbone
- D.
the 3'OH group on the ribose
- E.
All listed factors constrain the flexibility of nucleotides in nucleic acids
- 217.Which of the following is false about prokaryotic transcription?
- A.
Conserved sequences are found upstream from the starting point
- B.
10 bases before the start of transcription is known as the pribnow box
- C.
the sigma factor is released as transcription proceeds
- D.
The conserved sequences found upstream from the starting point are known as the -10 and -35 region
- E.
All answers are true
Back to top