Biochem Review
All the questions from Dan Yang
- 1.
Which one of the following procceses do bacteria use to protect against restriction endonuclease activity?
- A.
Acetylation
- B.
Hydroxylation
- C.
Amination
- D.
Methylation
- E.
Carboxylation
Correct Answer
D. Methylation -
- 2.
Which of the following statements is correct regarding buffer strength at pH = 7.3 (MOPS:pK=7.2; SHS:pK=5.5)?
- A.
MOPS is more effective against both acid and base
- B.
None of the Rest
- C.
MOPS is more effective against base and SHS is more effective against acid
- D.
MOPS is more effective against acid and SHS is more effective against base
- E.
SHS is more effective against both acid and base
Correct Answer
A. MOPS is more effective against both acid and base -
- 3.
In gel electrophoresis of DNA, the fragment that travels the furthest is the __________.
- A.
Least non-polar
- B.
Medium size
- C.
Most polar
- D.
Largest
- E.
Smallest
Correct Answer
E. Smallest -
- 4.
The amino group of glycine can exist either in the protonated form (-NH3+) or ast the free base (-NH2). In order to have 99% of the glycine in its protonated form, what must be the numerical relation be between the pH of the solution and the pKa of the amino group of glycine?
- A.
PH-pKa = 1
- B.
PH-pKa = 2
- C.
PH-pKa = 0
- D.
PH-pKa = -1
- E.
PH-pKa = -2
Correct Answer
E. PH-pKa = -2 -
- 5.
Which of the following primers can amplify the following DNA segment by PCR? GACTGGTCGCGGATAGCGTATAATATTTCGGAATACGGTATACCCGGATACGGATA
- A.
5'CTGACCAGCGCC and 5'GACTGGTCGCGG
- B.
5'ATAGGCATAGGC and 5'CCGCGACCAGTC
- C.
5'ATAGGCATAGGC and 5'TATCCGTATCCG
- D.
5'ATAGGCATAGGC and 3'CTGACCAGCGCC
- E.
5'TATCCGTATCCG and 3'GGCGCTGGTCAG
Correct Answer
E. 5'TATCCGTATCCG and 3'GGCGCTGGTCAG -
- 6.
Indicate the ionic species that predominate at pH 8 I: HCO3(-) II: Succinate(-1) III: H2CO3 IV: Succinate(-2) V: CO3(-2) VI: Succinic acid
- A.
III & V
- B.
I & V
- C.
I & IV
- D.
II & III
- E.
III & V
Correct Answer
C. I & IV -
- 7.
Which of the following statements is correct?
- A.
A spontaneous process can proceed spontaneously in the reverse direction with an appropriate change in reaction condition(s).
- B.
none of the statements
- C.
A reaction is said to be spontaneous when it can proceed in either the forward or reverse direction.
- D.
A spontaneous process can occur only if there is a large increase in entropy.
- E.
A spontaneous process always happens very quickly
Correct Answer
A. A spontaneous process can proceed spontaneously in the reverse direction with an appropriate change in reaction condition(s). -
- 8.
Indicate the ionic species that predominate at pH 3 I: Succinate(-2) II: CO3(-2) III: Succinic acid IV: H2CO3 V: Succinate(-1) VI: HCO3(-)
- A.
II & V
- B.
III & IV
- C.
I & IV
- D.
II & III
- E.
III & VI
Correct Answer
B. III & IV -
- 9.
Which of the following lists is the best choice of buffers for pH 3.8, 6.1 and 8.1 respectively?
- A.
Succinic, Tris and HEPES
- B.
HEPES, Phosphoric acid and Ammonia
- C.
Formic, MES, Tris
- D.
Succinic, HEPES and Ammonia
- E.
Tris, Succinic and Ammonia
Correct Answer
C. Formic, MES, Tris -
- 10.
Which of the followings is not likely to cause problem in a PCR experiment?
- A.
the temperature of the reaction mixture stayed constant all the time
- B.
both primers are complementary to several sites in the starting DNA sample
- C.
Both primers are inadvertently omitted from the reaction mixture
- D.
there are two single-stranded breaks in one strand of the template DNA molecule
- E.
there is a double-stranded break in the template DNA molecule
Correct Answer
D. there are two single-stranded breaks in one strand of the template DNA molecule -
- 11.
A phosphodiester bond links which carbons together on the ribose backbone?
- A.
4' to 2'
- B.
6' to 1'
- C.
5' to 3'
- D.
3' to 2'
- E.
3' to 4'
Correct Answer
C. 5' to 3' -
- 12.
What is the effective buffering range of HEPES?
- A.
7.1-9.1
- B.
6.2-8.2
- C.
6.5-8.5
- D.
3.5-11.5
- E.
1.5-3.5
Correct Answer
C. 6.5-8.5 -
- 13.
The volume of a solution of 1 M NaOH that must be added to adjust the pH from 4 to 9 in 20mL of a 100 mM solution of phosphoric acid is:
- A.
1mL
- B.
2mL
- C.
3mL
- D.
4mL
- E.
5mL
Correct Answer
B. 2mL -
- 14.
Which of the following DNA sequences is palindromic?
- A.
ACGATCGT
- B.
AGATTACA
- C.
ACTAATGA
- D.
AGATTAGA
- E.
CGATTTGC
Correct Answer
A. ACGATCGT -
- 15.
Which of the following restriction enzymes produce blunt ends (see Table 2)?
- A.
BamHI, HaeIII, PvuII, AluI
- B.
EcoRV, EcoRI, HaeIII, PvuII
- C.
AluI, PvuII, BglI, EcoRV
- D.
PvuII, EcoRV, HaeIII, AluI
- E.
All of the rest
Correct Answer
D. PvuII, EcoRV, HaeIII, AluI -
- 16.
The pH of a 100 mL solution containing 1 mL of 10 mM SHS, 1 mL of 10 mM MOPS and 20mL of 500mM HCL is (MOPS:pK=7.2; SHS:pK=5.5):
- A.
1.0
- B.
1.5
- C.
2.0
- D.
2.5
- E.
3.0
Correct Answer
A. 1.0 -
- 17.
Which of the following restriction enzymes produce identical sticky ends (see Table 2)?
- A.
BamHI and BglII
- B.
HpaII and XhoI
- C.
SalI and TaqI
- D.
All of the answer pairs
- E.
None of the rest
Correct Answer
A. BamHI and BglII -
- 18.
Select the answer that arranges bond strength from strongest to weakest :
- A.
Van der Waals, ionic, hydrogen bonds, covalent
- B.
Ionic, covalent, hydrogen, van der Waals
- C.
Van der Waals, hydrogen bonds, ionic, covalent
- D.
Covalent, ionic, hydrogen bonds, van der Waals
- E.
None of the rest
Correct Answer
D. Covalent, ionic, hydrogen bonds, van der Waals -
- 19.
DNA pol I can sequentially add deoxynucleotides to the ____ end of polynucleotides.
- A.
1'
- B.
2'
- C.
3'
- D.
5'
- E.
None of the rest
Correct Answer
C. 3' -
- 20.
Which of the following is always true concerning the base composition of DNA?
- A.
In each single strand, the number of A = G
- B.
In a molecule of double stranded DNA, A + C = T + G
- C.
In a molecule of double stranded DNA, the number of A + T = C + G
- D.
In each single strand, the number of A = T
- E.
None of the rest
Correct Answer
B. In a molecule of double stranded DNA, A + C = T + G -
- 21.
When compared to RNA, DNA lacks OH groups on the ______ of the pentoses:
- A.
1' carbon
- B.
2' carbon
- C.
3' carbon
- D.
5' carbon
- E.
None of the rest
Correct Answer
B. 2' carbon -
- 22.
Which of the following is not found in DNA
- A.
Uracil
- B.
Guanine
- C.
Cytosine
- D.
Adenine
- E.
Thymine
Correct Answer
A. Uracil -
- 23.
Absorption of food in the stomach and intestine depends on the ability of molecules to penetrate the cell membranes and pass into the bloodstream. Because hydrophobic molecules are more likely to be absorbed than hydrophilic or charged molecules, the absorption of orally administered drugs may depend on their pKa values and the pH in the digestive organs. If aspirin has an ionizable carboxyl group (pKa = 4.5). The fraction of aspirin available for absorption in the stomach (if pH=3.5) is
- A.
100/101
- B.
1/11
- C.
10/11
- D.
1/101
- E.
1/1
Correct Answer
C. 10/11 -
- 24.
Saquinavir is an antiretroviral that binds to HIV-I protease. Which of the following is true about HIV-I protease?
- A.
It is an aspartic protease with a catalytic Glu25-Gln26-His-27 active site.
- B.
It is a serine protease with a catalytic Asp32-His64-Ser-221 active site.
- C.
It is an aspartic protease with a catalytic Asp25-Thr26-Gly27.
- D.
It catalyzes the fusion of non-functional viral proteins into functional polyproteins.
- E.
None of the above.
Correct Answer
A. It is an aspartic protease with a catalytic Glu25-Gln26-His-27 active site. -
- 25.
Large doses of Saquinavir are necessary to inhibit HIV-I Protease because:
- A.
It is highly soluble in water and is excreted quickly in urine.
- B.
It is insoluble in water and must be taken with high fat foods, or it is not absorbed efficiently into the bloodstream.
- C.
It does not bind to blood plasma proteins and therefore cannot access infected lymphocytes.
- D.
It is not metabolized into an active form fast enough, so most of the dose is excreted.
- E.
None of the above
Correct Answer
B. It is insoluble in water and must be taken with high fat foods, or it is not absorbed efficiently into the bloodstream. -
- 26.
Which of the following statements about protein length is NOT true?
- A.
Synthetic efficiency determines the upper limit on length
- B.
3D structure stability determines the lower limit on length
- C.
5 residues is a lower limit, peptides start to fold after forming polymers of this length
- D.
All of the above are true
- E.
Two of the above are true
Correct Answer
E. Two of the above are true -
- 27.
PYMOL is:
- A.
Software for visualizing molecules
- B.
Software for calculating force fields and minimizing molecular potential energy
- C.
Software for simulating molecular interactions using ligand double-shell and full flesh
- D.
All of the above
- E.
Two of the above are true
Correct Answer
A. Software for visualizing molecules -
- 28.
Where does imatinib bind to the Bcr-Abl?
- A.
ATP-binding site
- B.
Substrate Binding Site
- C.
All of the above
- D.
None of the above but somewhere on Bcr-Abl
- E.
Imatinib targets the Bcr-Abl gene
Correct Answer
A. ATP-binding site -
- 29.
The BCR-ABL fusion oncogene is formed due to:
- A.
A random point mutation
- B.
A chromosomal translocation
- C.
An extra chromosome 21
- D.
All of the above
- E.
None of the above
Correct Answer
B. A chromosomal translocation -
- 30.
Why are researchers searching for an alternative to traditional NSAIDs?
- A.
Traditional NSAID use can lead to cardiovascular disorders
- B.
NSAID use can lead to gastrointestinal disorders
- C.
NSAIDs are very lipid soluble but not water soluble
- D.
NSAIDs are very water soluble but not lipid soluble
- E.
NSAIDs are too specific in the enzymes that they inhibit
Correct Answer
B. NSAID use can lead to gastrointestinal disorders -
- 31.
Which of the following functional groups are present on COX-2 inhibiting benzopyrans?
- A.
–CF3, –COOH
- B.
–BH2, –COOH
- C.
–SO3, –BH2
- D.
–CF3, –NH2
- E.
–SO3, –NH2
Correct Answer
A. –CF3, –COOH -
- 32.
Which of the following statements is not true about neuraminidase?
- A.
Its major role is to the spread infection by releasing virions.
- B.
It is a tetrameric surface glycoprotein antigen.
- C.
It degrades the layer of mucus in the gastrointestinal tract.
- D.
Zanamivir and oseltamivir are two inhibitors used to counteract neuraminidase.
- E.
None of the above.
Correct Answer
C. It degrades the layer of mucus in the gastrointestinal tract. -
- 33.
Which active sites on neuraminidase interact with its inhibitors?
- A.
Arginine 292 and glutamate 119
- B.
Glycine 129 and arginine 292
- C.
Valine 31 and glutamate 119
- D.
Alanine 292 and glutamine 119
- E.
Glycine 129 and valine 31
Correct Answer
A. Arginine 292 and glutamate 119 -
- 34.
What rate limiting step does raltegravir target during viral cDNA integration?
- A.
DNA Binding
- B.
3’-processing
- C.
Nuclear Translocation and Import
- D.
Strand transfer
- E.
Gap repair
Correct Answer
D. Strand transfer -
- 35.
Which of the following is not correct regarding the catalytic core domain (CCD) of the HIV-1 integrase?
- A.
It contains three acidic residues
- B.
It coordinates two essential magnesium ions
- C.
It contains a nuclear localization signal used to import viral cDNA into the nucleus
- D.
It is responsible for stabilizing folding of the protein
- E.
It is a highly conserved region of HIV-1 integrase
Correct Answer
D. It is responsible for stabilizing folding of the protein -
- 36.
The inhibition of factor IXa by benzothiophene prevents the activation of which factor in the coagulation cascade?
- A.
Factor VIII
- B.
Factor VIIIa
- C.
Factor IX
- D.
Factor X
- E.
Factor Xa
Correct Answer
D. Factor X -
- 37.
Factor IX is a zymogen. This means that factor IX is
- A.
An inactive enzyme precursor
- B.
Made of a single polypeptide chain
- C.
A serine protease
- D.
Part of the intrinsic pathway
- E.
A gene on the X-chromosome
Correct Answer
A. An inactive enzyme precursor -
- 38.
The protein insulin consists of two polypeptides termed the A and B chains. Insulins from different organisms have been isolated and sequenced. Human and duck insulins have the same amino acid sequence with the exception of six amino acid residues, as shown below. Which of the followings is true? Amino acid residues A8 A9 A10 B1 B2 B27 Human Thr Glu Gln Thr Asn Gln Duck Asn Asn Pro Arg Glu Lys
- A.
None of the answers
- B.
The pI of human insulin is lower than that of duck
- C.
The pI of human insulin is higher than that of duck
- D.
The pI of human insulin is twice that of duck
- E.
The pI of duck insulin is twice that of huma
Correct Answer
B. The pI of human insulin is lower than that of duck -
- 39.
Which of the following statements is correct regarding buffer strength at pH = 5.4 (MOPS:pK=7.2; SHS:pK=5.5)?
- A.
MOPS is more effective against acid and SHS is more effective against base
- B.
MOPS is more effective against both acid and bas
- C.
SHS is more effective against both acid and base
- D.
MOPS is more effective against base and SHS is more effective against acid
- E.
None of the rest
Correct Answer
C. SHS is more effective against both acid and base -
- 40.
DNA ligase is an enzyme that:
- A.
Is more specific than restriction endonucleases
- B.
Catalyzes the hydrolysis of the phosphodiester bonds between nucleotide residues
- C.
Catalyzes the hydrolytic excision of a nucleotide residue from the end of a polynucleotide strand
- D.
catalyzes bond formation coupled with the hydrolysis of ATP
- E.
None of the rest
Correct Answer
D. catalyzes bond formation coupled with the hydrolysis of ATP -
- 41.
The amino group of glycine can exist either in the protonated form (-NH3+) or as the free base (-NH2). In order to have 90% of the glycine in its free base form, what must be the numerical relation be between the pH of the solution and the pKa of the amino group of glycine?
- A.
pH-pKa = 2
- B.
pH-pKa = 0
- C.
pH-pKa = -2
- D.
pH-pKa = 1
- E.
pH-pKa = -1
Correct Answer
D. pH-pKa = 1 -
- 42.
What is the approximate isoelectric point of the peptide ALGRTEDM?
- A.
6.49
- B.
6.97
- C.
3.99
- D.
4.07
- E.
9.87
Correct Answer
C. 3.99 -
- 43.
Which of the following amino acid sequences give rise to the fluorophore of green fluorescent protein shown in Figure 2
- A.
TFG
- B.
NYG
- C.
SYG
- D.
QFS
- E.
GWS
Correct Answer
C. SYG -
- 44.
What is the approximate pI of the AAQTRADAEAA?
- A.
3.99
- B.
6.97
- C.
9.87
- D.
4.07
- E.
6.49
Correct Answer
A. 3.99 -
- 45.
Absorption of food in the stomach and intestine depends on the ability of molecules to penetrate the cell membranes and pass into the bloodstream. Because hydrophobic molecules are more likely to be absorbed than hydrophilic or charged molecules, the absorption of orally administered drugs may depend on their pKa values and the pH in the digestive organs. If aspirin has an ionizable carboxyl group (pKa = 4.5). The fraction of aspirin not available for absorption in the stomach (if pH=3.5) is
- A.
10/11
- B.
1/101
- C.
100/101
- D.
1/11
- E.
1/1
Correct Answer
D. 1/11 -
- 46.
Calculate the pI of Phenylalanine
- A.
5.94
- B.
6.07
- C.
6.30
- D.
5.71
- E.
5.76
Correct Answer
E. 5.76 -
- 47.
Indicate the ionic species that predominate at pH 8 I: NH3 II: NH4(+) III: H3PO4 IV: H2PO4(-) V: HPO4(2-) VI: PO4(3-)
- A.
II & V
- B.
II & IV
- C.
II & III
- D.
I & V
- E.
I & VI
Correct Answer
A. II & V -
- 48.
The volume of a solution of 1 M NaOH that must be added to adjust the pH from 1 to 9 in 20 mL of a 100 mM solution of phosphoric acid is:
- A.
1mL
- B.
2mL
- C.
3mL
- D.
4mL
- E.
5mL
Correct Answer
D. 4mL -
- 49.
Calculate the pI of the peptide ATRDAK?
- A.
11.51
- B.
10.21
- C.
5.05
- D.
6.89
- E.
3.03
Correct Answer
B. 10.21 -
- 50.
What is the isoelectric point of Histidine?
- A.
9.33
- B.
3.92
- C.
7.68
- D.
5.72
- E.
6.04
Correct Answer
C. 7.68 -
Quiz Review Timeline +
Our quizzes are rigorously reviewed, monitored and continuously updated by our expert board to maintain accuracy, relevance, and timeliness.
-
Current Version
-
Mar 22, 2022Quiz Edited by
ProProfs Editorial Team -
Apr 24, 2011Quiz Created by
Guptapk
- Aeronautics Quizzes
- Aerospace Quizzes
- Agricultural Science Quizzes
- Astrology Quizzes
- Astronomy Quizzes
- Atom Quizzes
- Biology Quizzes
- Biomechanics Quizzes
- Biostatistics Quizzes
- Biotechnology Quizzes
- Botany Quizzes
- Branches Of Science Quizzes
- Cytology Quizzes
- Easy Science Quizzes
- Ecology Quizzes
- Electrical Quizzes
- Embryology Quizzes
- Endocrinology Quizzes
- Engineering Quizzes
- Environmental Science Quizzes
- Epidemiology Quizzes
- Experiment Quizzes
- Forestry Quizzes
- Fossil Quizzes
- Gas Quizzes
- General Science Quizzes
- Genetics Quizzes
- Histology Quizzes
- Human Biology Quizzes
- Integrated Science Quizzes
- Invention Quizzes
- Library Science Quizzes
- Lighting Quizzes
- Liquid Quizzes
- Marine Biology Quizzes
- Microbiology Quizzes
- Nature Quizzes
- Neuroscience Quizzes
- Nuclear Science Quizzes
- Oceanography Quizzes
- Physics Quizzes
- Psychology Quizzes
- Science And Technology Quizzes
- Science Glossary Quizzes
- Science Knowledge Quizzes
- Science Practice Quizzes
- Scientific Method Quizzes
- Scientific Notation Quizzes
- Soil Science Quizzes
- Solar System Quizzes
- Solid Quizzes
- Zoology Quizzes
Back to top